Resident Evil Village

 PlayStation 5
User Score
7.7

Generally favorable reviews- based on 2852 Ratings

User score distribution:
  1. Positive: 2,177 out of 2852
  2. Mixed: 235 out of 2852
  3. Negative: 440 out of 2852
Buy Now
Buy on

Review this game

  1. Your Score
    0 out of 10
    Rate this:
    • 10
    • 9
    • 8
    • 7
    • 6
    • 5
    • 4
    • 3
    • 2
    • 1
    • 0
    • 0
  1. Submit
  2. Check Spelling
view
per page
  1. Kratos94j3jehdj
    Nov 3, 2021
    7
    This games has a good story but not enough zombies to kill even on the hardest difficult and horrible job creating heasinburgs factory that map is so trash every other map I prefer playing I can't stand that map
  2. Shaghel
    Nov 5, 2021
    9
    The best RE since RE1, amazing story, great game play, almost flawless an,,d very well engineered. An Exciting game for both old and new generations.....
  3. ParanskyRaj
    Nov 5, 2021
    9
    Resident Evil Village offers good fun with solid game time and a few bonus features. The pros here far outweigh the cons. It's just a shame that the action and technical aspects of the game outweighed the horror atmosphere and the story itself. Apparently, the developers wanted to please all players, but they succeeded in the end. The full review is on my gaming site here:Resident Evil Village offers good fun with solid game time and a few bonus features. The pros here far outweigh the cons. It's just a shame that the action and technical aspects of the game outweighed the horror atmosphere and the story itself. Apparently, the developers wanted to please all players, but they succeeded in the end. The full review is on my gaming site here: https://www.paranskyraj.cz/novinky/resident-evil-village-recenze/… Expand
  4. Damian99
    Nov 7, 2021
    9
    Amazing graphics, good story and great maps, I’m really glad Capcom kept the same idea as RE7 because these two games were really good and pretty similar too, I’d love to see a third game to complete the trilogy and even more games like this.
  5. ruddiman_
    Sep 28, 2022
    9
    Such a fun game and a weird turn for the series. I didn't like the Ethan from RE7, but somehow they managed to change my opinion of him by the end of the game. The series has been in worse condition story-wise before, so I'm hopeful they will continue to pleasantly surprise me. I like the idea of horror lore being introduced, but I REALLY hope the stray away from too much action (as isSuch a fun game and a weird turn for the series. I didn't like the Ethan from RE7, but somehow they managed to change my opinion of him by the end of the game. The series has been in worse condition story-wise before, so I'm hopeful they will continue to pleasantly surprise me. I like the idea of horror lore being introduced, but I REALLY hope the stray away from too much action (as is Resident Evil's past time to ruin horror with action).… Expand
  6. Eptamanhero
    Nov 17, 2021
    10
    The best game in this year, even better than the last part. Лучшая игра в этом году, даже лучше, чем прошлая часть.
  7. Mister04
    Nov 17, 2021
    10
    Great game
  8. DJ_Suvy
    Dec 2, 2021
    10
    I played all Resident Evil games so far and I am huge fan of series. I like classic zombies RE1, RE2, RE3 and RE4 but this RE Village it is the best RE game so far. Very good story, nice gunplay, crafting, awesome cutscenes and awesome sound makes this game a perfect masterpiece.
  9. Baterie
    Nov 19, 2021
    9
    god aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  10. MustafaX89
    Apr 2, 2023
    8
    Resident Evil Village is the newest installment in the long-running Resident Evil franchise. The series has seen many innovations and changes that sought to retain its dedicated audience and attract newcomers over the years. From fixed cameras to over the shoulder, and now first-person, Resident Evil has tried and succeeded in many approaches. Resident Evil Village took the greatestResident Evil Village is the newest installment in the long-running Resident Evil franchise. The series has seen many innovations and changes that sought to retain its dedicated audience and attract newcomers over the years. From fixed cameras to over the shoulder, and now first-person, Resident Evil has tried and succeeded in many approaches. Resident Evil Village took the greatest aspects of the seventh installment, which was the start of first-person, while managing to implement elements that remain close to the heart and soul of what the series is all about.… Expand
  11. EuropeanSamurai
    Nov 23, 2021
    10
    Very good game and very good Resident Evil. I enjoyed the story, the gameplay and the differents areas that unlocked slowly.
  12. Fedoskin
    Nov 25, 2021
    10
    This game is so beautiful!! I love capcom for their quality of games.
    A dramatic story, great graphics and interesting gameplay
    Thanks, Capcom
  13. abdurhmanzain
    Feb 28, 2023
    2
    The part is far from called Resident Evil, almost devoid of horror, and the game has become more action-packed and boss battles are less bad than I expect, so I see this part as less quality in all respects compared to Resident Evil 7
  14. Terrenghi
    Nov 28, 2021
    10
    Que Fantástico, um dos melhores da série, parabéns a Capcom e a Playstation, o jogo é perfeito no PS5, obrigado por ter dublagem em Português do Brasil.
  15. Homic
    Dec 29, 2021
    10
    a wonderful game with a good story and interesting puzzles.................
  16. Marinhosplay00
    Dec 7, 2021
    10
    To my mind the game is amazing with many things like resident evil 4 , good charaters and scenery is wonderful.
  17. MaynAnt
    Dec 16, 2021
    9
    seamos sinceros y no nos dejemos llevar porque el juego es nuevo, ya que todo el mundo se queja simplemente porque creen que la edad del juego define que tan bueno es. El juego es aire fresco para los fans, con un toque de Resident Evil 4 en el tema de la ambientacion y el contexto pero con un sistema de armas, puzzles y sobre todo jefes que impresiona mucho con jefes interesantes comoseamos sinceros y no nos dejemos llevar porque el juego es nuevo, ya que todo el mundo se queja simplemente porque creen que la edad del juego define que tan bueno es. El juego es aire fresco para los fans, con un toque de Resident Evil 4 en el tema de la ambientacion y el contexto pero con un sistema de armas, puzzles y sobre todo jefes que impresiona mucho con jefes interesantes como Donna Beneviento que consistia en buscarla mientras bebes asesinos y un feto de 2 metros de largo te persigue hasta Karl Heisenberg que fue una batalla de jefe muy interesante ya que como en todo Resident Evil todo termina con explosiones agregandole un toque subiendote a un tanque con motosierra, lanzacohetes y una metralleta. no me pueden venir con lo de: " Es que el juego quita el estilo de la saga ya que es mas accion que terror". Desde cuando que un pueblo de personas infectadad te persiga mientras salvas a la hija de el presidente es un juego de terror? y eso lo hace malo? lo que importa de los Resident Evil es la jugabilidad, historia y toques de la saga como los puzzles que lleve, no que sea un juego de terror. El juego tiene una muy buena historia y el final es digno, simplemente un muy buen juego. Ademas que aparecio el gran Chris Redfield... Se puede pedir mas?… Expand
  18. Piriteraneo
    Dec 18, 2021
    9
    Charismatic characters,fun gameplay,one of the best re atmospheres and an emotional narrative. The first half is pretty scary,but the second half is action-centred. And thats not bad,it gets the middle point between action and horror,its like 7 and 4 gave birth to this game. Recommended
  19. Dogguin
    Jul 27, 2022
    8
    Um jogo incrível, Com Gráficos ótimos e agrada os fãs tanto os que querem Ação e tanto os querem Terror, Um jogo para todos os gostos.
  20. 13keeper13
    Mar 20, 2022
    10
    absolutely amazing , just gorgeous. if you love playing games , this is pure art and you"ll love it. beautiful graphics , beautiful story line , beautiful lighting , beautiful music , beautiful characterization , full of beautiful view and scenes , just a beautiful peace of art . well done Capcom.
  21. awar_7
    Dec 20, 2021
    6
    Resident Evil Village se puede considerar un buen juego, pero como Resident Evil me ha dejado un regusto un poco amargo. El juego es divertido, la historia está bien y la ambientación qué voy a decir... derrocha personalidad por los cuatro costados con un apartado técnico espectacular. Sin embargo, viniendo de Resident Evil 7 o los remakes del 2 y del 3... esperaba un resultado mejor porResident Evil Village se puede considerar un buen juego, pero como Resident Evil me ha dejado un regusto un poco amargo. El juego es divertido, la historia está bien y la ambientación qué voy a decir... derrocha personalidad por los cuatro costados con un apartado técnico espectacular. Sin embargo, viniendo de Resident Evil 7 o los remakes del 2 y del 3... esperaba un resultado mejor por parte de Capcom que lo que me ha ofrecido con RE Village.… Expand
  22. Milan1992
    Dec 21, 2021
    10
    I'm not big fan of Resident Evil franchise, but this one is probably the game of year for me. Great story, incredible atmosphere, perfect gameplay, also every boss fight is spectacular, choice of weapons is huge, i really recommend you to play this game, you will enjoy and probably you will play it at least twice.
  23. iS3uuud
    Jan 20, 2022
    9
    This game is Amazing I Like it, Great story great gameplay, the movement was not good enough
  24. LuigimonsterD
    Nov 3, 2022
    10
    De lo mejorcito que he jugado, espero que ya salga resident evil 9, pues lo espero con ansias, CAPCOM viene haciendo las cosas muy bien.
  25. Leonsjm
    Mar 25, 2022
    9
    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  26. Kostas_Spirou
    Aug 10, 2023
    6
    This is my very first Resident Evil game, and while I think that it's a pretty fun experience overall, the game itself has some major flaws.
    It mostly suffers from pacing issues, and it feels like it doesn't know what it wants to be, it mixes action and horror in such a bizarre way, but it's not a good action game nor a good horror game either.
    I absolutely adore the Eastern    This is my very first Resident Evil game, and while I think that it's a pretty fun experience overall, the game itself has some major flaws.
    It mostly suffers from pacing issues, and it feels like it doesn't know what it wants to be, it mixes action and horror in such a bizarre way, but it's not a good action game nor a good horror game either.

    I absolutely adore the Eastern European/Gothic Horror setting with the vampires and the werewolves, it's excellent. Most areas are incredibly detailed, the atmosphere is disturbing, and the buildings look very beautiful.

    I have to say, the gameplay mechanics are better than I expected, the game is fun to play, the guns feel and sound satisfying, and there is a good variety of tools to use.

    Ι found most of the characters to be quite annoying, except from few of them that were lowkey entertaining, the Four Lords are overall intimidating and pretty much the highlight of the game.

    The writing is very amateurish and straight up bad, there aren't any peaks in the story and it's very short, personally it took me around 8 hours to finish it, and I think some areas should have been expanded, especially the castle.

    Lastly, the dialogue is very cheesy and sometimes the game takes itself too seriously for no reason, which hurts the overall tone, specifically in the second half of the story, there are some questionable moments that take away the immersion completely.

    I really appreciate the effort that was put into the game though, the Dimitrescu Castle looks great, there are many areas to explore, the environment looks really nice, the village is cool and there are many things to do in it, decent amount of details here and there, I honestly enjoyed it a lot, it really is a well crafted game after all.

    Final Rating: "Decent" ~ 6/10.    … Expand
  27. Marc81
    Dec 27, 2021
    9
    I was sure that I will buy that game cause the last RE was also great. At Black Friday I took the chance for low money and during the Xmas I’ve started playing. And I have to say. YES it’s a great game. Story and topic is a bit different but that’s no problem at all. It makes so much fun the whole story the artwork and immersion is great. 92/100 points
  28. khalilgilvan
    Jan 1, 2022
    10
    This game is incredible good.It’s a must for all gamers.Nowadays is rare a game be so well made like this.You must play it.I just wish the characters would be more used in the game.Lady Dimitrescu shouldn’t die so quick
  29. joaopoc1998
    Oct 30, 2022
    9
    For me is the best game of the franchise.
    Incredibçe graphic.
    Gameplay is great as ever
  30. Codemac93
    Jan 8, 2022
    8
    Resident Evils have been very hit and miss I found throughout the years but RE Village was very good. The game is two different games. The first half was a scary cat and mouse chase that turned nightmarish to eerie and painful exploration puzzler. The second half took the nightmare creatures and put them into a shootem up. I would recommend to anyone to play but play RE 7 first to get theResident Evils have been very hit and miss I found throughout the years but RE Village was very good. The game is two different games. The first half was a scary cat and mouse chase that turned nightmarish to eerie and painful exploration puzzler. The second half took the nightmare creatures and put them into a shootem up. I would recommend to anyone to play but play RE 7 first to get the feel for it.… Expand
  31. Toffeltrasa
    Jan 15, 2022
    9
    Amazing. Like it's f*cking incredible. The atmosephere, attention to detail and design of everything is on masterpiece level.
  32. daniellaaborman
    Jan 14, 2022
    9
    Resident evil: village is my favorite from all resident evil games. A really good quality, the aim assist is perfect. The characters are amazing, with cool and small details. But the handsome one is Heisenberg, i'm in love with him. He is the special one who game made funnier and fiery. But the one minus is Ethans death. He went through a lot but he received actually nothing. I know thatResident evil: village is my favorite from all resident evil games. A really good quality, the aim assist is perfect. The characters are amazing, with cool and small details. But the handsome one is Heisenberg, i'm in love with him. He is the special one who game made funnier and fiery. But the one minus is Ethans death. He went through a lot but he received actually nothing. I know that his the aim was to save Rose, but he needed to stay alive. But the game is perfect!… Expand
  33. Proyect_zion
    Nov 20, 2022
    7
    Por momentos es un juego divertido pero en general carece de identidad, cómo una punto medio entre RE6 y RE7, asimismo el DLC no es para nada bueno. Sin duda el mejor RE de los últimos 10 anos es RE2 remake y Capcom debería apuntar más hacia esa fórmula.
  34. Schmaerzkeks
    Nov 17, 2022
    8
    Solides Spiel mit einer tollen Optik im Spiel (Zwischensequenzen sehen irgendwie billig aus). Der Umfang passt auch, sowie das Gameplay was RE-Kenner ja durchaus mögen.
    Gab einige Sequenzen die ich etwas lächerlich fand, trotzdem ist dieses Spiel ein Must Have.
    8/10
  35. tonjonas
    Aug 28, 2023
    9
    My first and definitely not last RE. Great horror atmosphere, visually beautiful sceneries, and streamlined gameplay, ideal for me.
  36. Lijon88
    Aug 18, 2023
    10
    I wanted to give 9 becouse the last location of haizenberg destroyed for me the whole atmosphere of this village but some nice leady and her jucy big benefits made my decision to give it 10 (joke). Game is really amazing especialy if you play it in vr2 like i did for the first time. So many jumpy moments makes me change my pants few times during the first run. Everysingle trophy is makingI wanted to give 9 becouse the last location of haizenberg destroyed for me the whole atmosphere of this village but some nice leady and her jucy big benefits made my decision to give it 10 (joke). Game is really amazing especialy if you play it in vr2 like i did for the first time. So many jumpy moments makes me change my pants few times during the first run. Everysingle trophy is making this game challanging and even after 4-5 runs i still was not tired of this game. Hope just in next re they will letyou get teophies when you play in vr like it was in 7.… Expand
  37. zzCass
    Jun 19, 2023
    7
    RE8 é bom, serve com uma boa continuação e com uma história simples e com personagens marcantes. Porém, não é melhor que seu antecessor, pois perde elementos de terror e acrescenta muita ação desnecessária, principalmente na segunda metade. Acredita que devia ter mantido a essência do RE7. É um bom jogo, cenários bonitos e macabros, história legal, personagens marcantes, porém quis seRE8 é bom, serve com uma boa continuação e com uma história simples e com personagens marcantes. Porém, não é melhor que seu antecessor, pois perde elementos de terror e acrescenta muita ação desnecessária, principalmente na segunda metade. Acredita que devia ter mantido a essência do RE7. É um bom jogo, cenários bonitos e macabros, história legal, personagens marcantes, porém quis se parecer demais com o RE4 e esse foi seu erro.… Expand
  38. SolidHutyr
    Feb 6, 2022
    8
    Big Booba
    Big Booba
    Big Booba
    Big Booba
    Big Booba
    Big Booba
    Big Booba
    Big Booba
  39. cptfrancisco
    Sep 4, 2022
    10
    A perfect sequel to RE7's formula. Everything just keeps getting better. Perfect story, gameplay and insane graphics. RE Engine is AMAZING.
  40. WendigoAlado
    Feb 9, 2022
    10
    es un buen juego lo recomiendo mucho la saga Resident Evil vuelve a su survival horror y es lo que me encanta de este juego.
  41. Starr1993
    Feb 14, 2022
    8
    The game was a really really good game and definitely had some scary things about it especially the monster that attacks you. Graphics are also pretty awesome too and and very entertaining. The only issues I have with this game is it felt like the theme kept changing going from scary tall lady(Lady Dimistrescu), to ghost hallucinations(Beneviento), to monstrous sea monsters(monreau), andThe game was a really really good game and definitely had some scary things about it especially the monster that attacks you. Graphics are also pretty awesome too and and very entertaining. The only issues I have with this game is it felt like the theme kept changing going from scary tall lady(Lady Dimistrescu), to ghost hallucinations(Beneviento), to monstrous sea monsters(monreau), and a factory with machine monsters( Heisenberg). Some levels didn't feel like true Resident Evil survivor horror I don't like the idea of ghost hallucinations in resident evil nor dolls being possessed, that more for games like silent hill or outlast....Resident evil is about poeple getting infected with a virus and changing into bioweapons not silly unbelievable ghost hallucinations also just wish some things were explained more as for as the story but overrall really good game that stayed true to the RE formula besides the beneviento level.… Expand
  42. AmirkHAN-THR
    Feb 12, 2022
    10
    The one of the best part of resident evil after that resident evil 4 I played enemies and boss fights and atmosphere more scary than RE7
  43. Pizza_Doc
    Mar 10, 2022
    9
    What a great game. Nice gameplay, engaging plot, stunning graphics and atmosphere. One of the best games of the year.
  44. slicelook
    May 14, 2023
    0
    this game was a big mess made for children who dont know any better anyone who liked it is a bot
  45. Chelbynsky
    Mar 24, 2022
    9
    This review contains spoilers, click expand to view. É um ótimo jogo, porém os vilões foram mal aproveitados, a ambientação que se passa o game é incrível, porém falta o elemento de terror.… Expand
  46. Ygs
    Jul 14, 2022
    5
    Please don't buy this game. By buying this game, you will kill more Resident Evil. It is a forgettable experience, there is nothing special or new.
  47. GuzmanEconomist
    Mar 1, 2022
    10
    Excelente juego, lo gráficos están buenos, la historia interesante, los combates divertidos, el audio es excelente, aprovecha el dualsense muy bien.
  48. TheGrouch
    Mar 18, 2022
    9
    Great game. I love the different sections that seem to reflect the elements of past games. The last level was my least fav but even that section was good. Great graphics and all around just a fun game to play. I got sucked in a few times and ended up playing until 2:00 am because I couldn’t put the controller down.
  49. Thegamesup
    Dec 16, 2022
    8
    اللعبه حلو بس مشكلتها انها ماخذين من رزدينت ايفل 4 مرا تقيمي 8.3
  50. alisadr
    Mar 8, 2022
    9
    this game have one of the best graphic and storys in games .everything is in hight quality.thank you capcom we want re9 very soon.
  51. Nyff
    Jun 9, 2022
    10
    A true master piece. A lot of people would say RE7 is better but I disagree. I had much more fun playing this game. If only the game came in VR man.. Even though it didn't it's still a master piece.
  52. MAHDIBR4F
    Mar 6, 2022
    10
    بازی بشدت خوب و سرگرم کننده ای هست بشدت محیط های زیبایی داره عالی هست.
  53. St0rMSaiyajiN
    Mar 9, 2022
    10
    This review contains spoilers, click expand to view. Capcom has really created a top notch game and now this has set a benchmark for all FPS horror games according to me.
    Let's be honest by saying that capcom has redeemed itself with this game after the Resident Evil 3 Remake. I personally liked RE3 too.
    The visuals. Stunning. Breathtaking. It also maintains the atmosphere of the horror game. Trust me. You are going to find plenty of wallpapers in this game. It is absolutely beautiful.
    Coming to the gun mechanics, It is good and they did not mess around with it much keeping it simple and clean, like RE7.
    The story. Woah. Dislike this review if you did not cry, cause I cried, for 2 whole days.
    Now back to the overall gameplay. They absolutely smashed it. You will find parts where you need to use your wits, your accuracy (trust me, you're going to need this), also your courage (never have I ever played a resident evil game that is as terrifying as this one).
    Again, the visuals are absolutely beautiful.    … Expand
  54. ChiefScarneck
    Mar 13, 2022
    9
    Some of my favorite horror games are games that make you go through a whole array of emotions, not just fear. The horror genre appeals to me because of that, and some of the best stories are those where the protagonist willingly chooses to go through a harrowing experience for the sake of those they love. This gives weight and purpose behind the scares, rather than just a game that's scarySome of my favorite horror games are games that make you go through a whole array of emotions, not just fear. The horror genre appeals to me because of that, and some of the best stories are those where the protagonist willingly chooses to go through a harrowing experience for the sake of those they love. This gives weight and purpose behind the scares, rather than just a game that's scary for the sake of being scary. By this definition, it's no secret Resident Evil Village is one of my all time favorite horror games.

    While others may disagree with me when I say this, but I think Resident Evil 7 was the perfect way for Capcom to not only revive the fear the Resident Evil franchise is known for, but to give it a personal story. Ethan Winters may not have been a character to stand on the same ground as Chris, Jill, Claire, or Leon, but he is an every man, a character that could've been any of us. Even his face is obscured or Mike Wazowski-ed to make it feel more like we've become a character in a Resident Evil game. In 7, Ethan doesn't have that much of a character or personality, but once Village comes along, we know exactly what kind of person he is, not only physically, but emotionally. In other Resident Evils, you fight off a hoard of zombies because you're either solving a mystery, fulfilling your duty, on an assignment, or some other obligation; in 7 and Village, Ethan is going into a hoard of of shapeshifting enemies for those he loves, adding a lot of heart into the series that it wasn't known for previously. While the story may not be the most special thing in the world, it's still a personal story about a father and going to the ends of the earth for his daughter, and that's something special. It reminds me of the original Silent Hill, another great horror game owing much to its personal story.

    As for the gameplay and visuals itself, a major throwback to Resident Evil 4. The gameplay is some of the best the series has to offer and the environments are diverse and fun to explore. I enjoy the variety of horror in Village, giving it more of a unique identity than standard body horror. There's gothic horror, psychological horror, suspense, and others to keep the game interesting and feels like you're fighting something different every time you enter a new part of the game.

    Resident Evil has come a long way, and while I wouldn't say Village is the best the series has done, it does give me confidence for the future. It convinces me that Capcom knows what they want to do with the series and they keep me waiting with bated breath for the next installment in my favorite horror game franchise.    … Expand
  55. Dhome
    Mar 19, 2022
    10
    This review contains spoilers, click expand to view. Nice gameplay vguvuvucucucuchcux ucucucufucucucucucucucuucucucucucucucucucucyxyxyxyxyxyxyxuxhcucucucufucfucufucucucucucucucuccucuccucuuguufufyyfgyyyffyyfufyfuffuufufufuffuuffyfuyfyffyyfutfuytytuttutuuytuut… Expand
  56. Infamous747
    Mar 23, 2022
    10
    Resident hasn't felt so fresh In years everything about this just gripped me from start to finish with a compelling story, awesome bosses and great variety of weapons with a mix of combat in tight and open areas.
  57. Kabersh
    Apr 27, 2022
    10
    Прикольное продолжение 7 части. Много экшена и сюжетных поворотов. Концовка заставляет поплакать.
  58. RULO_182
    Mar 27, 2022
    10
    Juegarral como un templo. Gran historia, mejores personajes y un gran final. Recomendadisimo.
  59. Proof23RU
    Mar 31, 2022
    8
    Топ 1 горячая милфа десятилетия!)) Хороший резик! На пс5 очень оптимизировано и ровно идёт.
  60. Ogeday_Han
    Mar 31, 2022
    9
    I really enjoyed playing, capcom did a great job i give you that. Game is hard for sure but every single kill gives huge satisfaction. Story is full of surprises and just right amount, not too long not too short. it took me 11 hours to finish the story and played in easy mode. Graphics, sound effects, mechanics and gameplay is amazing. Looting from houses satisfying as well. I loved it.
  61. Camk325
    Apr 2, 2022
    8
    I bought it on ps4 because I wanted to play it and it was on sale. I’ve played through it several times and it’s one of my favorite games now. There were points in the hardest difficulty that were super difficult. Like in one of the final boss fights you aren’t able to heal or block damage when you block so it’s two hits and you’re down. Fun if you love playing with strategy.
  62. mortalvii
    Apr 20, 2022
    10
    My first Resident Evil game and thoroughly enjoyed it. Loved the graphics and story elements. Combat & menus were easy to navigate.
  63. MosiLand
    Apr 21, 2022
    10
    As always, Awesome was one of the best Evil series. Many thanks thanks thanks.
  64. Nindo_1
    May 1, 2022
    9
    This game is so much fun, it’s scary at times but mainly is just a fantastic game with fantastic visuals.
  65. Aashir52970
    May 29, 2022
    10
    One of the best RE games out there....
    Pros
    1. Extremely well optimised for Next-gen
    2. Boss battles are an adrenaline rush
    3. Village setting is extremely creepy and unsettling
    4. More combat focussed than RE7: biohazard

    Cons
    Only being that it was not as scary as RE7....

    Overall.....a masterpiece
  66. Morados9
    Jan 3, 2023
    9
    Me encantan estas historias de terror. No sé dónde esta hantes. Pensaba que el cine lo era todo.
  67. Silent-Heal
    Jun 11, 2023
    8
    The first game in the series that I played. High-quality game - development, unlike Ubisoft. The rating is high also because of Shadows of Rose, which is very good. But, there are stupidities too, not plausible barriers through which one cannot pass. And the character is even slower than an ordinary old man in reality and cannot even dodge, only block and even then takes damage.
    But I    The first game in the series that I played. High-quality game - development, unlike Ubisoft. The rating is high also because of Shadows of Rose, which is very good. But, there are stupidities too, not plausible barriers through which one cannot pass. And the character is even slower than an ordinary old man in reality and cannot even dodge, only block and even then takes damage.
    But I liked the game - original, realistic, high quality good optimization - no "Ubisoft" (Bugsoft) - bugs, crooked textures even on the main characters, empty senseless running around, etc.
    But the 7th and 4th are, at least. very similar and no longer willing to go through the same thing with other characters.
    And I love the maximum difficulty, but guys, it shouldn't be based on replay to pass, and so many time to spend, replay so many times to find out where to hide and how long you have to sit there.... don't be meticulous! I'd enjoy it more, a lot more if I didn't have to count ammo. And you need to make the character normal, as in reality, but you did, the developers of this game, he is like an old man and can't do anything.
    There are also puzzles, which is good.

    Please don't mix the sexual genre with games, especially when it's not exactly 'the 18+' and the game's story is not about that, but yes there are things inherent in this genre, such as Detorit: become human and Soulstice. Horror should not be associated with this genre... And many people like to play horror games (and thriller) In addition, in this game there are hints of dirty, not beauty.

    DLC.... stop it, why i need to buy after buy? and it's expensive.    … Expand
  68. obilleimai
    Aug 28, 2022
    7
    They nailed the atmosphere and the characters but the thing that dissapoints me most is the gore.Its nothing compared to RE2 remake gore mechanics.I just wish we got a resident evil game again with gore like RE2 remake
  69. Casualgamer1432
    Sep 24, 2022
    7
    This review contains spoilers, click expand to view. Biased but the whole Heisenberg part makes me never wanna play it again. The whole game wasn’t really scary for me but still good enough to enjoy the first time through… Expand
  70. efano_mar05
    May 24, 2023
    7
    Juego aceptable con una historia aceptable, aunque fue muy corta. Para más horas debes comprar los dlc de las expansiones, pero no era la solución, debió ser más largo desde un principio.
  71. ArgeRamos
    Oct 26, 2022
    10
    Un buen juego con algunos aires a resident Evil 4 pero sin perder su originalidad
  72. OriginalMan
    Nov 2, 2022
    10
    I bought it on sale and only played the 3rd person perspective. Worth the price? It’s definitely worth the 40 dollars I paid for it. I beat this game 3+ times and truly love the atmosphere, movement, gunplay, enemy variation, sounds, and story. It reminds me of a successor to re4 but with the updated graphics and movement of re2&3 remake. Gameplay: Addicting and linear. A lot ofI bought it on sale and only played the 3rd person perspective. Worth the price? It’s definitely worth the 40 dollars I paid for it. I beat this game 3+ times and truly love the atmosphere, movement, gunplay, enemy variation, sounds, and story. It reminds me of a successor to re4 but with the updated graphics and movement of re2&3 remake. Gameplay: Addicting and linear. A lot of backtracking if you want to 100 percent it but for me it didn’t feel forced or convoluted. In my opinion the gameplay is right in the sweet spot between action and survival horror.

    Soundtrack: I didn’t really notice it too much. Not bad but didn’t stand out. Audio: The sounds are well designed and detailed. A lot of work went into the guns, enemies, and actions that you do constantly throughout the game.

    Visuals: The RE Engine on the ps5 is impressive. I didn’t notice any pop in or slow down but I’m also not looking for imperfections. The resolution and graphics seem great to me and there was only one time during the final boss that I noticed the pre-rendered cutscene differentiate between the gameplay that broke the immersion. Story: It is so unique and twisted where I did not see it going. It’s had me hooked. I could see how some would find it campy or too much. But it is a resident evil game. The game respects my time and that is important these days. I can pick up and play for small sessions or long. I can set save points strategically to try bosses over and over to get short times to complete challenges. I can set save points to play parts over to kill a ton of enemies with specific weapons to unlock more stuff. The game is a resident evil game through and through.    … Expand
  73. Badro_22
    Nov 3, 2022
    10
    This review contains spoilers, click expand to view. Amazing game and i love how eithan hide his face when i look. Fantastic game… Expand
  74. DieterfallCZE
    Mar 6, 2023
    8
    Great :)
  75. Xenomorph121
    Nov 24, 2022
    8
    La historia es muy buena, en contenido me a parecido un poco corto, pero mucho mejor que el 3 y el 2 remake, muchas armas, buenos momentos de tensión, sólo casi al final que con cierto jefe sentí que jugaba el 6. Le añadiría un poco de velocidad a Ethan sin romper elemento Survival; otra cosa es que es muy rejugable, eso probablemente para algunos justifique el precio.
  76. EKYR
    Jul 31, 2023
    9
    really enjoyed this game with some interesting puzzles, abit less horror but nontheless still full of passion and enthusiasm from the developers at capcom to deliver this level of game which is honestly impressive. Not many major complaints for the game as it is exactly the kind of game i quite enjoy. However i do have some minor gripes such as the main character ethan being quite funnyreally enjoyed this game with some interesting puzzles, abit less horror but nontheless still full of passion and enthusiasm from the developers at capcom to deliver this level of game which is honestly impressive. Not many major complaints for the game as it is exactly the kind of game i quite enjoy. However i do have some minor gripes such as the main character ethan being quite funny and fearless in face of such horror, some of the dialogue that comes out of his mouth is just freaking comedic genius timing. The game on Normal mode is too easy but i still enjoyed it quite alot. World building feels contained yet open ended and imaginative, characters are quite interesting and the story was certainly something interesting to me. A really strong recommend from me even if you have not played the previous RE games, this is good!… Expand
  77. OnlyGoryGames
    Dec 4, 2022
    8
    I hear bad things about this game, but when I played, I had more then just fun. I had it preordered and was playing the beta when it hit me. “This game is fantastic”. Zero buyers remorse, instead I can’t wait to buy DLC.
  78. juniortiger
    May 17, 2023
    10
    I love story and lot action and excellent graphic and haptic feedback control
  79. Joe2539
    Jan 3, 2023
    10
    Very Good Good Good Good Good Good Good Good Good Good Good Good Good Good Good
  80. Reaper0
    Jan 5, 2023
    9
    I Really Liked This Game
    The Maint Bosses and areas are fantastic
    The Story is nothing special but i liked it
    The Gameplay is same as in the other resident evil games and beacuse of that it was perfect Really creepy atmosphere
    The sound are good and the animations too
  81. brunordacosta
    Feb 14, 2023
    10
    This review contains spoilers, click expand to view. A história é ambientada em uma cidade do leste europeu, contando a saga de Ethan Winters, depois do ocorrido na residência dos Bakers. Passado alguns anos após o incidente, Ethan está com Mia e sua filha Rose, tentando seguir a vida e superar os traumas do passado. No começo do jogo, Chris Redfield invade sua casa matando Mia e levando Rose e Ethan. Após um incidente no transporte dos dois, Ethan acorda e não sabe onde está sua filha. Daí começa sua jornada em um vilarejo hostil, com diversas criaturas folclóricas como lobisomens, vampiros e bruxas... No decorrer da história, fica claro que tais criaturas eram seres humanos que foram expostos ao Cadou, parasita geneticamente modificado que foi exposto ao Mofo. A vila possui uma espécie de anciã/profetisa, conhecida como Mãe Miranda e esta possui quatro Lordes, Alcina Dimitrescu, Donna Benneviento, Salvatore Moreau e Karl Heisenberg. O jogo tem ambientes abertos e fechados, trazendo um realismo casuístico à experiência, já que Ethan já tem as experiências passadas e não é tão indefeso como no jogo anterior. No modo padrão, não é um jogo difícil, então recomendo o modo Intenso para aqueles que já estão habituados com a saga. Nesse modo, a experiência se torna bastante desafiadora. Os gráficos estão excelentes, a jogabilidade é incrível e possui uma boa diversidade de armas, o que pode tornar a gameplay interessante. Para os amantes de Resident Evil 4, o Village possui muitas referências e o intuito da Capcom era justamente trazer a nostalgia desse clássico e preparar o público para o Remake que será lançado em 2023. Não acho que o jogo possui muita ação, pois em diversos momentos há partes de sobrevivência e terror, principalmente na casa Benneviento, que por sinal é o ponto mais alto do jogo. Tem uma quantidade boa de puzzles e de colecionáveis. Destaque para a atuação da atriz que deu vida para a personagem Alcina Dimitrescu, que a tornou um ícone da série. Vale muito a pena jogar Resident Evil Village, recomendo!… Expand
  82. Arqam105
    Feb 14, 2023
    10
    Classic Resident Evil experience. The story got way more intense and interesting with this one. Overall a great improvement to already superb Resident Evil 7. Now looking forward to the final part of the trilogy.
  83. YAKYAK
    Mar 2, 2023
    10
    Waited to play this on PSVR2, and I am glad I did! I can't speak to the flat-screen experience of the game, but the VR version is FANTASTIC!

    The game has an excellent sequence of environments and evolution of enemy types, and the first half or so of the game is very spooky and scary. I was checking corners with my pistol or frantically fleeing a dangerous horde. The second half turns    Waited to play this on PSVR2, and I am glad I did! I can't speak to the flat-screen experience of the game, but the VR version is FANTASTIC!

    The game has an excellent sequence of environments and evolution of enemy types, and the first half or so of the game is very spooky and scary. I was checking corners with my pistol or frantically fleeing a dangerous horde. The second half turns into more of a combat fest, which is fine because the VR gunplay is awesome!

    I beat it in 10 hours on the casual difficulty, and had fun the whole time. I was still pressured to perform in combat, and there are many moments in the early game when you are frantically trying to reload your gun as an enemy is bearing down on you. Later, with experience, some massive enemy pops out and you, the now seasoned vet, pull open your coat, pull out an explosive device, throw it, grab the sniper rifle from your back, fire once, cock in a new shell, fire again- all fluidly, practiced, and business-like as if you are a professional monster-slayer. So, you develop into a combat god yourself as the game goes along.

    100% worth the money and time. This is not just a game, it's a literal adventure to enjoy.    … Expand
  84. hidratos
    Mar 16, 2023
    8
    Better VR implementation than RE7. Amazing visuals in PSVR2 and controls. Be aware that DLC’s doesn’t support VR.
  85. ZackH25
    Mar 23, 2023
    6
    This is a game of two halves. The first side of the game is great. The castle area and the haunted doll house were very well designed and atmospheric. The second half of the game was very linear and quite boring especially with the big fish area and the factory area. The gameplay overall was nothing special and the open world is quite bland except from a few houses. Could have been scarierThis is a game of two halves. The first side of the game is great. The castle area and the haunted doll house were very well designed and atmospheric. The second half of the game was very linear and quite boring especially with the big fish area and the factory area. The gameplay overall was nothing special and the open world is quite bland except from a few houses. Could have been scarier if the game was set in night time and had more stealth enemies trying to kill you rather than mindless enemies. Not much replay value unless you like to speed run the game. The story was just dumb especially with certain characters being unnecessarily dumb.… Expand
  86. Kap1toska
    Mar 23, 2023
    10
    Просто отличная игра! Люблю игры с таким сюжетом графикой просто корм для глаз. Оуиащуиуущиаовивщвощаовлвовоовлоалвлвлвоовововолвлвлвлвлвллвлвлвлвлвлвлвлвллвлвлвлвлвллввллвлвлвлвлвлвллвлв
  87. JstNormalPerson
    Mar 24, 2023
    10
    After the excellent seventh part, you hope to see no less quality of the plot and gameplay. So Capcom did it. They surpassed themselves, this part is filled with plot twists, references, it is quite important for the franchise. The DLC gave a lot of plot and reflection. That was a great experience. Thank you Capcom!
  88. Ady_936
    Mar 26, 2023
    10
    I like it, I have 210 hours in it and I think it is worth a try, you will not regret it,2021 Game of The Year.
  89. GeovanneAshwood
    Mar 30, 2023
    9
    It's a good game. A love letter to Resident Evil 4. Ethan is a hell of a good character.
  90. Killervoid
    Mar 28, 2023
    5
    This game is average Ethan is still a man child, and rose is ugliest most stupid baby/teen she acts like a 10 year old when she's 17 **** years old ,ass character she's deserves her bullying. Enjoyable gameplay like re4 but ammo is just handed to you much better than re7 please go back to survival horror or at least re4 gameplay.
  91. Danstars1
    Jul 17, 2023
    8
    Good resident evil overall. Not the best but one of the better games in the series
  92. fer0n
    Apr 7, 2023
    8
    VR Version

    I only ever played it in VR and I expected to dislike it due to it being a port. It's definitely not a VR-first game, which you can tell. But I overall really enjoyed it and give it two thumbs up for some really nice interactions, graphics, horror elements and gameplay. Parts of the game were too much horror to really enjoy it, but very well done. Here are a few things    VR Version

    I only ever played it in VR and I expected to dislike it due to it being a port. It's definitely not a VR-first game, which you can tell. But I overall really enjoyed it and give it two thumbs up for some really nice interactions, graphics, horror elements and gameplay. Parts of the game were too much horror to really enjoy it, but very well done.

    Here are a few things that could be better:
    - I often missed events during cut-scenes, since I was looking somewhere else and didn't know where to look. I don't see an easy fix for that, since it's obviously made for flatscreens and not a problem there. Probably a necessary evil
    - The demo should be free (not cost 0.25, why?)
    - If I grab a "special object" such as a letter, when I let go I drop everything I was holding on to (flashlight, gun, ...) which was annoying
    - I don't like having to drop guns and see them reappear in their slot. Even if it's just for the added immersion, I'd love to put them back manually, or at least have them move back to their slot as soon as you let go. Not a big deal, but I think it makes a big difference in VR
    - I was missing some haptic feedback when breaking something with the gun in hand
    - I would've loved to grab objects by hand to examine them, but it isn't a big part of the game and probably not worth the effort. Still would've loved it.

    I really enjoyed the gun mechanics (haptic feedback, adaptive trigger, headset vibration, reloading, ...) and loved the coat mechanic. Really clever idea. I was also happy to see an option to use "touch" to grab objects, I was afraid I'd have to squeeze that trigger really hard all the time.    … Expand
  93. BeckyGG
    Apr 2, 2023
    7
    Fun but not the greatest this series has got to offer. It's very solid though. The story is silly and over the top as it should be and the villains are all great except mother Miranda character is kind of boring. It kind of trails off into less interesting stuff at the end.
  94. nbaoldboy
    Apr 5, 2023
    6
    It is very obvious that some places are put to lengthen and this is very annoying.Its kil my game focus and its kill my motivation to see whats happend in end.Also this game not even scary tho.
  95. MutenRoshi
    Apr 7, 2023
    8
    This review contains spoilers, click expand to view. Ein tolles auf Action Fokussiertes Resident Evil in der Tradition von Teil 4 und 5.
    Grafik: Die RE Engine zeigt mal wie's was sie kann und das ist einfach nur Herrlich anzusehen.
    Game Design: Die Level Architektur ist Resident Evil Typisch mal wieder einfach nur gut auch wenn insgesamt etwas schwächer als zb. im RE2 Remake.
    Es gibt das gewohnte Backtracking und genug zu entdecken Abseits der Main-Quest Hauptwege.
    Gegen Ende Eskaliert die Action immer mehr.

    Was negative auffält ist das eher mäßige treffer Feedback was in den Remakes wesentlich besser ist.

    Der Sprung vom RE7 auf RE8 kommt mir ähnlich vor wie der von der Alten PSone Trilogie und Code Veronica auf RE4 was die Gewichtung von Action und Survival Horror angeht.

    Leider sind die Antagonisten im ihrer Persönlichkeit nicht so Präsent wie ich mir das gewünscht hätte. Insgesamt bleiben sie eher flach und nutzen ihr Potenzial was definitiv da ist nicht ganz aus.

    Die Story erklärt mag ich sehr gerne. Sie bleibt Resident Evil Typisch eher Flach aber erklärt die Geschehnisse aus Resident Evil 7 und gibt Interessante Einblicke im die Entstehungsgeschichte von Umbrella. Das Ende hat einen Riesigen Cliffhanger und lässt hoffen oder fürchten das RE9 ein Action geladenes Spektakel werden könnte in dem Chris Redfield eine Zentrale Rolle Spielt möglicherweise mit Gegner die Waffen benutzen wie damals in RE5 und RE6.

    Insgesamt ein Spaßiges wenn auch zu kurzes Resident Evil Abenteuer.    … Expand
  96. zaci
    Apr 17, 2023
    7
    The game is mostly based around action rather than horror. The first 30 minutes were pretty scary but it fell off after that. Gameplay is amazing and the mal design is brilliant. Reminds me of DS1 in some areas. Overall pretty fun game.
  97. mostafa2000
    Apr 18, 2023
    0
    It was not a scary game at all and with a new and awful story.and cute boss fights.
  98. Zhileby
    Apr 28, 2023
    8
    Excellent game. This game continues the story of resident evil 7 and finishes it in a interesting way. It doesn't have the same vibe as the previous game. Resident evil 7 was more scary while Village was more like an adventure. I suggest you give this game a try!
  99. dams_hyuga
    Sep 11, 2023
    9
    Un très bon jeu horrifique qui change vraiment des autre jeux l'ambiance est parfaite
  100. Samnew92
    May 18, 2023
    0
    Load of boring nonsense. Typical resident evil! Just a load of dull suspense.
Page:

Awards & Rankings

23
#23 Best PlayStation 5 Game of 2021
4
#4 Most Discussed PlayStation 5 Game of 2021

Critic Reviews

All reviews »
Metascore
84

Generally favorable reviews - based on 108 Critic Reviews

Critic score distribution:
  1. Positive: 100 out of 108
  2. Mixed: 8 out of 108
  3. Negative: 0 out of 108
  1. CD-Action
    Dec 7, 2021
    90
    Similarly to Resident Evil 4 back in the day, Village will attract a new generation of players and redefine the franchise for the modern age. I guess it’s time to stop looking back and counting on the series to return to its roots. Capcom is well aware of those roots and willingly draws from them to create something new but still infused with Resident Evil’s spirit. Village is not perfect, but neither was RE4, and once again it’s easy to turn a blind eye to the flaws, because overall it’s an amazing game. [07/2021, p.56]
  2. Cubed3
    Nov 22, 2021
    90
    Resident Evil Village feels like such a culmination. Bringing together elements from the franchise all the way up to now and crafting what looks to be the next step of survival horror, it embraces every aspect of the franchise. While the insidious dread of Resident Evil VII is missing, there are still plenty of scares. The monster designs are fantastic, from the generations undead, the fury of the Lupine beasts, to the towering monstrosities. It's well worth delving into the concept art and 3D models to enjoy them fully. The story is just the right amount of silly with the terrifying, and the odd dash of the surreal. The combat is smooth and fluid, best evidenced in the addictive Mercenaries mode. All of these elements added together make quite possibly the best Resident Evil to date, and a foundation for a fresh new generation of terror.
    Read full review
  3. PLAY! Zine
    Jun 8, 2021
    80
    RE: Village is a mixture of almost all previous Resident Evil elements, making the most of both survival horror and puzzle intensity, but with the primary stage being left for the more action-like nature of Resident Evil 4. It has some great story moments, sprinkled with a few lacklustre characters that are still overshadowed by its most notable characteristic – most detailed environment to date.
    Read full review
See all critic reviews »