User Score
7.7

Generally favorable reviews- based on 2852 Ratings

User score distribution:
Buy Now
Buy on

Review this game

  1. Your Score
    0 out of 10
    Rate this:
    • 10
    • 9
    • 8
    • 7
    • 6
    • 5
    • 4
    • 3
    • 2
    • 1
    • 0
    • 0
  1. Submit
  2. Check Spelling
  1. Oct 1, 2022
    9
    Resident Evil Village is excellent during the beginning and middle but then becomes mediocre towards the end. The concept of the village and fleeing to survive was thrilling and I enjoyed the castle chapter however the game lost its spark from the factory onwards. It was a great idea to work in crafting, but it didn’t feel satisfying. Overall a good game.
  2. Oct 1, 2022
    9
    I just love the new RE concept introduced in RE7 - and this one just takes it to another level. It is better than RE7 in almost every aspect. It is not as scary as the previous one (it has only one freaky episode with the doll master boss) but much more action-oriented, which is super cool — no need to count every bullet now, you can simply fight your way through the lycans. The levelI just love the new RE concept introduced in RE7 - and this one just takes it to another level. It is better than RE7 in almost every aspect. It is not as scary as the previous one (it has only one freaky episode with the doll master boss) but much more action-oriented, which is super cool — no need to count every bullet now, you can simply fight your way through the lycans. The level design and the atmosphere are beautiful. I love to play it on a PS5, and since the game has tons of collectibles (and a fun post-game mercenaries mode) I guess I'm still not done with it. Expand
  3. Sep 28, 2022
    9
    Such a fun game and a weird turn for the series. I didn't like the Ethan from RE7, but somehow they managed to change my opinion of him by the end of the game. The series has been in worse condition story-wise before, so I'm hopeful they will continue to pleasantly surprise me. I like the idea of horror lore being introduced, but I REALLY hope the stray away from too much action (as isSuch a fun game and a weird turn for the series. I didn't like the Ethan from RE7, but somehow they managed to change my opinion of him by the end of the game. The series has been in worse condition story-wise before, so I'm hopeful they will continue to pleasantly surprise me. I like the idea of horror lore being introduced, but I REALLY hope the stray away from too much action (as is Resident Evil's past time to ruin horror with action). Expand
  4. Sep 24, 2022
    7
    This review contains spoilers, click expand to view. Biased but the whole Heisenberg part makes me never wanna play it again. The whole game wasn’t really scary for me but still good enough to enjoy the first time through Expand
  5. Sep 22, 2022
    10
    This game is awesome. Graphics and atmosphere is very good. The story is very strong and answered too many questions. The gameplay is too good for a horror game.
  6. Sep 10, 2022
    6
    okay game, with a meh ending and an extremely disappointing post game

    Mercenaries is 3 linear levels that you play through once and it just ends
    I would have been pissed if I payed for it, glad I got it from a friend's family share
  7. Sep 6, 2022
    3
    Isso é Resident Evil mesmo ou foi um engano? Sério... Se colocassem outro nome ia combinar melhor, a capcom simplesmente fez um jogo qualquer e genericão e usou o nome Resident Evil pra fazer mais sucesso, é um dos piores "Resident Evil" que já joguei e ainda usaram uma coroa peituda pra atrair essa geração de zé brônha, que confesso que ela é a melhor parte do jogo, realmente rsrsrs TodoIsso é Resident Evil mesmo ou foi um engano? Sério... Se colocassem outro nome ia combinar melhor, a capcom simplesmente fez um jogo qualquer e genericão e usou o nome Resident Evil pra fazer mais sucesso, é um dos piores "Resident Evil" que já joguei e ainda usaram uma coroa peituda pra atrair essa geração de zé brônha, que confesso que ela é a melhor parte do jogo, realmente rsrsrs Todo o resto é um lixo Expand
  8. Sep 4, 2022
    10
    A perfect sequel to RE7's formula. Everything just keeps getting better. Perfect story, gameplay and insane graphics. RE Engine is AMAZING.
  9. Aug 28, 2022
    7
    They nailed the atmosphere and the characters but the thing that dissapoints me most is the gore.Its nothing compared to RE2 remake gore mechanics.I just wish we got a resident evil game again with gore like RE2 remake
  10. Aug 27, 2022
    4
    Mais uma vez a Capcom peca em um jogo sem sal, confuso e sem identidade nenhuma. Vamos lá, porque tem muita coisa pra comentar dessa maça. Os Winters estão no jogo, o que é bom, para ter um melhor entendimento daquele horroroso jogo chamado "Resident Evil 7", a trama do jogo é melhor entendida com o desenrolar da mesma, sem precisar de DLCs para um melhor entendimento como aconteceu noMais uma vez a Capcom peca em um jogo sem sal, confuso e sem identidade nenhuma. Vamos lá, porque tem muita coisa pra comentar dessa maça. Os Winters estão no jogo, o que é bom, para ter um melhor entendimento daquele horroroso jogo chamado "Resident Evil 7", a trama do jogo é melhor entendida com o desenrolar da mesma, sem precisar de DLCs para um melhor entendimento como aconteceu no anterior (coisa mais estupida), aí ganha um ponto. Os inimigos mais descartáveis que já vi em um jogo de Survival Horror, que nada tem haver com o conceito da franquia em si, nota zero aí. Ambientação, é o quesito mais forte do jogo, tudo é bem feito e construído, encaixado com a trama de forma satisfatória. Puzzles, até que tem bastante, mas muito fáceis pra mim, não precisei quebrar a cabeça com eles; poderiam ter sido desafiadores pra compensar um pouco as outras cagadas no jogo. A trilha sonora é interessante. Enfim, dou nota 4,0/10 no geral. Mas ainda sim, bem melhor que o jogo anterior. Obs: Ainda sou da opinião que a Capcom deveria acabar de vez com a franquia, pois eles estão sem ideias e cagando pra ela, isso já está mais do que notado. Praticamente estão fazendo dinheiro com o nome "Resident Evil" e só, que foi de uma franquia notória dentro do cenário Survival Horror para ser a franquia mais incompreensível. Lamentável mas é a realidade. Expand
  11. Aug 26, 2022
    8
    Beginning & first area 10/10, second area 9/10, rest of the game 8/10. Yeah they probably did a few extra steps for the big tiddie vampire dominatrix lady, but its a very solid game nonetheless. Very recommended and 4K 60fps with raytracing on PS5 is nice as well.
  12. May 29, 2022
    10
    One of the best RE games out there....
    Pros
    1. Extremely well optimised for Next-gen
    2. Boss battles are an adrenaline rush
    3. Village setting is extremely creepy and unsettling
    4. More combat focussed than RE7: biohazard

    Cons
    Only being that it was not as scary as RE7....

    Overall.....a masterpiece
  13. Aug 15, 2022
    10
    Easy 10/10

    The best series of RE. The Character is so strong in this one, and the atmoshpere and environment is so scary yet beautiful. Even i finished it along time ago, but still its had marked in my mind until now.
  14. Aug 14, 2022
    0
    This review contains spoilers, click expand to view. All that they were inspired by from re4, these castle, village, merchant, typewriters, suitcase these new antagonists did not like at all.
    bad, that wasn’t of Los Iluminados and Osmund Saddler, he best. The story was very boring.
    Expand
  15. Aug 10, 2022
    7
    As a newcomer to the Resident Evil series I was able to pretty quickly pick up on the nuances of the game. I enjoyed the puzzle survival horror game, but I couldn't help but feel like I was missing some of the nostalgia that has made this series a mainstay for many console generations. I enjoyed the game but some of the combat controls and gun feedback felt a little lacking. Would onlyAs a newcomer to the Resident Evil series I was able to pretty quickly pick up on the nuances of the game. I enjoyed the puzzle survival horror game, but I couldn't help but feel like I was missing some of the nostalgia that has made this series a mainstay for many console generations. I enjoyed the game but some of the combat controls and gun feedback felt a little lacking. Would only recommend this game to fans of the series. Expand
  16. Aug 10, 2022
    8
    Nach Teil 7 Biohazard konnte mich auch Village wieder vollends überzeugen. Es waren ein paar gute Schreckmoment dabei (hätten gern mehr sein können) und die Spielzeit von knapp 9h hat mir auch zugesagt. Bin ich ja nicht so ein Fan von gestreckten Spielen und erfreue mich gern mal über lineare Titel. Teilweise war die Welt etwas unübersichtlich und ich bin wirr umhergelaufen. Hat aber aufNach Teil 7 Biohazard konnte mich auch Village wieder vollends überzeugen. Es waren ein paar gute Schreckmoment dabei (hätten gern mehr sein können) und die Spielzeit von knapp 9h hat mir auch zugesagt. Bin ich ja nicht so ein Fan von gestreckten Spielen und erfreue mich gern mal über lineare Titel. Teilweise war die Welt etwas unübersichtlich und ich bin wirr umhergelaufen. Hat aber auf jeden Fall Spaß gemacht und ist zu empfehlen. Expand
  17. Aug 7, 2022
    7
    Story: 6/10
    Gameplay: 7/10
    Graphics:10/10
    Music: 8/10
    Replay: 5/10
    Buying Advice: 7/10
  18. Jul 27, 2022
    8
    Um jogo incrível, Com Gráficos ótimos e agrada os fãs tanto os que querem Ação e tanto os querem Terror, Um jogo para todos os gostos.
  19. May 10, 2021
    7
    One of the best possible games, I definitely suggest you play it, it means that his knowledge is wonderful. In my opinion, this series of flower planting companies is really a hot company
  20. Jul 18, 2022
    9
    A good game, with good optimization and a good plot, of course the game has moved far from the Resident Evil theme, very cool atmosphere and level design, well done capcom!
  21. Jul 16, 2022
    9
    Jogo extremamente imersivo, evolução notória em tudo do 7, ambientação fantástica, gameplay cadenciada, destaque para a dublagem em português absolutamente impecável.
  22. Jul 14, 2022
    10
    As someone who has been a fan of survival horror since the original Alone in the Dark, this is possibly the best horror-survival game I've ever played. I've played games that are scarier(SH1), had better stories(SOMA), but I've never played one that had such an excellent grasp of the genre's gameplay.

    Resdient Evil: The Village's combat is thrilling and difficult. Resources are
    As someone who has been a fan of survival horror since the original Alone in the Dark, this is possibly the best horror-survival game I've ever played. I've played games that are scarier(SH1), had better stories(SOMA), but I've never played one that had such an excellent grasp of the genre's gameplay.

    Resdient Evil: The Village's combat is thrilling and difficult. Resources are scarce, and enemy encounters are varied and interesting. There is a great and expansive system of buying and upgrading weapons. Although not terrifying, there are parts of the game that are quite creepy, cycling through the many types of horror gaming from classic Resident Evil in a mansion, to Layers of Fear, to the claustrophobic industrial setting. There are many nods to previous RE games, almost like a greatest hits version of the series. There's something very similar to RE4's controller-throwing opening combat sequence where you're swarmed by endless enemies. Once you get past that opening hurdle, the game becomes much more free-from in something like the hub-based open world you see in many immersive action games, with light RPG elements. The level design is excellent, reminiscent of Dark Souls, and rewards exploration, as you uncover hidden new areas.

    What kicks it up to a 10 is hard to explain. The game is just cool. Its stylish and bleak visuals, the fantastic graphics, and great character design of your adversaries blend together perfectly. There is also a subversive undercurrent of dark humor that I loved in the writing and dialog.

    I don't give out 10s often, but I believe I might never play a survival horror game as good as this.
    Expand
  23. Ygs
    Jul 14, 2022
    5
    Please don't buy this game. By buying this game, you will kill more Resident Evil. It is a forgettable experience, there is nothing special or new.
  24. Jul 12, 2022
    9
    A spiritual successor to Resident Evil 4, Resident Evil Village at first made me question what the game was really about. Was it the story, the game play or the overall feeling of the game that got me so hooked?
    Well, after playing the game for about 20 hours (yes - that includes several playthroughs), I can without doubt say - all of the above.
    Resident Evil Village takes whats great
    A spiritual successor to Resident Evil 4, Resident Evil Village at first made me question what the game was really about. Was it the story, the game play or the overall feeling of the game that got me so hooked?
    Well, after playing the game for about 20 hours (yes - that includes several playthroughs), I can without doubt say - all of the above.

    Resident Evil Village takes whats great about RE4 and repackages it into a current gen experience. A few players will be turned off with the almost RE3 feel of the introductory chapter, but after continuing with the story they will meet balanced game play featuring horror, action, RPG-elements and more.

    Sure, alot of new players to the franchise will not feel as at home as I were, but Im a firm believer the absolute majority of players will find this game to be one to remember. By all means not perfect, but a bloody good time - pun intended.
    Expand
  25. Jul 9, 2022
    10
    i really enjoined playing resident evil village this is the greatest resident evil game today. besides this game remind me a lot to resident evil 4. in my opinion I liked the characters, the environment, the gameplay and the story. definitely this game deserves my respect and the respect of everyone.
  26. Jul 9, 2022
    10
    May 10, 2021

    Madre mía madre mía, Lo acabo de terminar, 10 horitas (llendo rápido) me ha durado más que anteriores entregas sin lugar a dudas y solo puedo decir, MASTER PIECE. El juego se siente, se ve y se disfruta de una manera que me ha tenido enganchado al mando como hacía tiempo que no lo estaba. Un equilibrio execelente entre terror, survival horror, acción. intriga. Grato
    May 10, 2021

    Madre mía madre mía, Lo acabo de terminar, 10 horitas (llendo rápido) me ha durado más que anteriores entregas sin lugar a dudas y solo puedo decir, MASTER PIECE. El juego se siente, se ve y se disfruta de una manera que me ha tenido enganchado al mando como hacía tiempo que no lo estaba. Un equilibrio execelente entre terror, survival horror, acción. intriga. Grato recuerdo. Gracias a Capcom por esta pedazo de obra. A nivel técnico en PS5 diría que ha ido 90% perfecto contando alguna bajadilla de frames en laguna zona muy puntual, todo lo demás perfecto
    Expand
  27. Jul 8, 2022
    9
    This is just great , love the game , the graphics , the story so far.. It's a hell of a trip really really trippy.
  28. Jul 8, 2022
    10
    i have already beat the game four time and its my first resident evil game and i love it the boss fights were actually hard when i played the game on hardcore and village of shadow the graphics were amazing and the bonus content was very entertaining and the most memorable part of the game was castle dimitrescu so the summary is capcom did a very good job so buy this game
  29. Jun 25, 2022
    9
    Resident evil Village

    This game is fun game.İf you played and didn't like resident evil 7,this game is still a good choice because it is better,you loot enemies and explore some castle.After that you kill the bosses.There are some main bosses.Their locations can easily be found.This doesn't make game shorter because last boss location is far. Graphics are good but some areas are
    Resident evil Village

    This game is fun game.İf you played and didn't like resident evil 7,this game is still a good choice because it is better,you loot enemies and explore some castle.After that you kill the bosses.There are some main bosses.Their locations can easily be found.This doesn't make game shorter because last boss location is far.


    Graphics are good but some areas are bad.Main character Lady feels like it is not a horror game just an action game...İf you are looking for horror that is not a right game...

    You can find items easily and get weapons.Bosses and enemies are ridiculous I think...


    Pros Graphics
    Areas
    Weapons

    Cons
    Not.a horror game
    End area
    Easy?

    Score 85.
    Expand
  30. V7q
    Jun 19, 2022
    8
    I recommend playing and familiarizing yourself with this game. I had fun playing this game.
  31. Jun 17, 2022
    9
    Capcom did an excellent work with this game! Creppy village, amazing characters, visuals, sounds. Freaky stories leaking out of the screen, depressing notes, and the story overall kept me playing this game over and over again. I finished it 3 times with different difficulties.
    The great news is that we will get 3rd person view with the new patch!
  32. Jun 13, 2022
    10
    very very good game ......... perfect ..... dark ..... best resident foe ever
  33. Jun 11, 2022
    9
    This great mix of Resident Evil 4 and Resident Evil 7 is personally my most favorite game in series.
    I still think RE 4 had better gunplay but overall I liked more story, characters, puzzles, and atmosphere in RE 8.
    Stories in Resident Evil have never been a strength it was the thrilling survival horror gameplay and atmosphere. Well, in RE 8 it is finally pretty good EMOTIONAL story
    This great mix of Resident Evil 4 and Resident Evil 7 is personally my most favorite game in series.
    I still think RE 4 had better gunplay but overall I liked more story, characters, puzzles, and atmosphere in RE 8.

    Stories in Resident Evil have never been a strength it was the thrilling survival horror gameplay and atmosphere.
    Well, in RE 8 it is finally pretty good EMOTIONAL story with some great twists and I did not expect to be able to really love the Resident Evil story.
    Still it is a standard mysterious Resident Evil story where everything is explained in the end but this time it has some emotions.
    I would be happier if the story unfolded gradually but still it is my most favorite story in the series.
    Ethan Winters gets more personality and bigger and more interesting role here.

    The legendary Chris Redfield is amazing, same for Karl Heisenberg and Lady Dimitrescu.
    There are some really interesting ideas for puzzles that I really liked.
    I like that merchant is back where you can buy supplies and guns or upgrade guns and treasures are back. The village is beautiful, soundtrack is great and boss fights are amazing and epic.
    The environment is stunning there are many different impressive and well-designed buildings such Dimitrescu castle, the factory or the village itself.
    The loading screens are barely visible in this game and the dualsense is also used well for first-person shooter.

    Regular enemies are more interesting than the mold guys in RE 7 and I would say everything was done better here than in RE 7 except one thing and that is my biggest problem with the game.
    It ain't too scary. One section in the game when you are defenseless and you are hiding from something was amazing but overall it is more about action.
    It is about preferences so if you do not mind it or even you like more action you will not obviously see it as a mistake.

    I would find one more thing that I did not like and that is the game is quite short for me.
    It is standard to rest games in series but I personally want more than 8 hours for the first playthrough.
    But after 25 years it still holds up for me best game in the series and one of the best at this time with highest quality at every point.
    Great game with great story, graphic, gameplay, soundtrack, characters. I would recommend to fans of series and fans of this genre. I can't wait for next part in this legendary franchise.
    Expand
  34. Jun 9, 2022
    10
    A true master piece. A lot of people would say RE7 is better but I disagree. I had much more fun playing this game. If only the game came in VR man.. Even though it didn't it's still a master piece.
  35. May 31, 2022
    10
    Passed the game in one breath, everything is super, the plot, design, music. The characters are bright and charismatic. The graphics are great.
  36. May 30, 2022
    9
    Oh, how I wanna go back to Castle Dimitrescu to play hide and seek. Alcina Dimitrescu is, without a doubt, one of the best video game characters ever created. My favorite drag queen. It is a gradual downfall after her chapter, unfortunately.
  37. May 25, 2022
    10
    its really really beautiful game and very fun and ethan clothes is better than Resident evil 7 and it have more weapons and ammo types
  38. Aug 15, 2021
    10
    This review contains spoilers, click expand to view. the best game of the world insane the game that challenge the other games insane Expand
  39. May 11, 2022
    10
    A temática do jogo é sensaciona! Nunca imaginei que Resident Evil chegaria nisso um dia! A parte do castelo é extraordinária! As personagens que te perseguem são todas extremamente bem feitas e te deixam super tenso toda vez que aparecem! Um belo exemplo de como um survival horror deve ser, parabéns!!!
  40. May 10, 2022
    9
    I knew this was gonna be a good game but i didnt expect to love it this much!
    +atmosphere
    +story
    +good mix of slow horror and fast action
    +great characters
    -gunplay can be annoying at first
  41. May 3, 2022
    8
    An excellent horror-action game. Some of the best gameplay in the series. Unique encounters to accompany the gameplay. Excellent and unique level design. Something for every fan of the series. Complaints come from the story where parts of it are comical and don't make sense. Enemy design is good but could be improved.
  42. May 3, 2022
    10
    The game is very very interesting this game should be one of the best games very underrated game there is many bosses many enemies and many weapons you can use and upgrade
  43. May 1, 2022
    9
    This game is so much fun, it’s scary at times but mainly is just a fantastic game with fantastic visuals.
  44. Apr 29, 2022
    9
    Only thing keeping it from a 10 from me is that it doesn’t really blow my mind. But the story, graphics, and characters are all great. Solid game
  45. Apr 27, 2022
    10
    Прикольное продолжение 7 части. Много экшена и сюжетных поворотов. Концовка заставляет поплакать.
  46. Apr 2, 2022
    8
    I bought it on ps4 because I wanted to play it and it was on sale. I’ve played through it several times and it’s one of my favorite games now. There were points in the hardest difficulty that were super difficult. Like in one of the final boss fights you aren’t able to heal or block damage when you block so it’s two hits and you’re down. Fun if you love playing with strategy.
  47. Apr 22, 2022
    9
    Excellent production quality. Excellent graphics. Could have been better boss fights. Great story. Great game.
  48. Apr 21, 2022
    10
    As always, Awesome was one of the best Evil series. Many thanks thanks thanks.
  49. Apr 21, 2022
    10
    best game (my opinion) i had ever seen , this is the only game who let me feel that feels and i am excited to re9 anshallah
  50. Apr 20, 2022
    10
    My first Resident Evil game and thoroughly enjoyed it. Loved the graphics and story elements. Combat & menus were easy to navigate.
  51. Mar 31, 2022
    9
    I really enjoyed playing, capcom did a great job i give you that. Game is hard for sure but every single kill gives huge satisfaction. Story is full of surprises and just right amount, not too long not too short. it took me 11 hours to finish the story and played in easy mode. Graphics, sound effects, mechanics and gameplay is amazing. Looting from houses satisfying as well. I loved it.
  52. Mar 31, 2022
    10
    Village is a really fun game and absolutely a great sequel to RE7 and that also links perfectly to past events of the saga.
  53. Mar 31, 2022
    9
    This review contains spoilers, click expand to view. Just what he hell was that. The setting was so good, there were brutal scenes, and got even a bit interesting story, gameplay is pretty fine. The only reason it is not a 10 because after that mini tank scene the perspective was a bit off. Expand
  54. Mar 31, 2022
    9
    A great fun game. As a long time fan of the series, this one is very much in line with the campy-action-horror of re4 with some survival elements littered throughout. A fun cast of characters, amazing beautiful scenery, anxiety inducing combat (if you play in hardcore mode,) and truly a game worth playing if that’s your thing.
  55. Mar 31, 2022
    8
    Топ 1 горячая милфа десятилетия!)) Хороший резик! На пс5 очень оптимизировано и ровно идёт.
  56. Mar 27, 2022
    10
    Juegarral como un templo. Gran historia, mejores personajes y un gran final. Recomendadisimo.
  57. Mar 25, 2022
    9
    aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  58. Mar 24, 2022
    9
    This review contains spoilers, click expand to view. É um ótimo jogo, porém os vilões foram mal aproveitados, a ambientação que se passa o game é incrível, porém falta o elemento de terror. Expand
  59. Mar 23, 2022
    10
    Resident hasn't felt so fresh In years everything about this just gripped me from start to finish with a compelling story, awesome bosses and great variety of weapons with a mix of combat in tight and open areas.
  60. Mar 22, 2022
    10
    It’s a beast great graphics great characters excellent act resident evil always a special experience
  61. Mar 20, 2022
    10
    absolutely amazing , just gorgeous. if you love playing games , this is pure art and you"ll love it. beautiful graphics , beautiful story line , beautiful lighting , beautiful music , beautiful characterization , full of beautiful view and scenes , just a beautiful peace of art . well done Capcom.
  62. Mar 19, 2022
    6
    Really clunky combat. Not really scary besides that one section. Horrid writing. Boring artstyle and enemies (barring Heisenberg's part to some degree). Everything is humanoid and feels even less like a bioweapon (but I guess it's not fair to detract from it because of that alone, the previous entries also do this but are good, the point is that the enemies are just boring).
  63. Mar 19, 2022
    10
    This review contains spoilers, click expand to view. Nice gameplay vguvuvucucucuchcux ucucucufucucucucucucucuucucucucucucucucucucyxyxyxyxyxyxyxuxhcucucucufucfucufucucucucucucucuccucuccucuuguufufyyfgyyyffyyfufyfuffuufufufuffuuffyfuyfyffyyfutfuytytuttutuuytuut Expand
  64. Mar 18, 2022
    9
    Great game. I love the different sections that seem to reflect the elements of past games. The last level was my least fav but even that section was good. Great graphics and all around just a fun game to play. I got sucked in a few times and ended up playing until 2:00 am because I couldn’t put the controller down.
  65. Mar 17, 2022
    6
    I like the Atmosphere the Grafik, and many bosses, but it is no Resident Evil !

    If i go to Formula 1 i want see cars If i Buy Resident Evil i want Gore, Splatter, ragdoll and a bit jumpscares and i have the moste not found in RE Village. Resident Evil 2 Remake was the best remake so far and even that is not burtal enough. so last Resident Evil i have Preordered ! i wait
    I like the Atmosphere the Grafik, and many bosses, but it is no Resident Evil !

    If i go to Formula 1 i want see cars

    If i Buy Resident Evil i want Gore, Splatter, ragdoll and a bit jumpscares and i have the moste not found in RE Village.

    Resident Evil 2 Remake was the best remake so far and even that is not burtal enough.

    so last Resident Evil i have Preordered !

    i wait better for RE1 REMAKE !
    Expand
  66. Mar 17, 2022
    0
    After being absolutely blown away playing Resident Evil Biohazzard I was so ramped up rdy for its first sequel The Village that I could hardly contain myself while it was installing and updating. An at the start I was just as impressed with the grafix and and atmosphere of it that i jumped right in expecting a great game. It wasent until I started to encounter the most ridiculous lookingAfter being absolutely blown away playing Resident Evil Biohazzard I was so ramped up rdy for its first sequel The Village that I could hardly contain myself while it was installing and updating. An at the start I was just as impressed with the grafix and and atmosphere of it that i jumped right in expecting a great game. It wasent until I started to encounter the most ridiculous looking lycans I have ever seen wielding Malee weapons and working in tandem with a bunch of vampires that I realized what a big mistake I had made buying this game. I mean seriously who the hell came up with this garbage idea of vampires and werewolves in a game series based on a viral outbreak cause by an evil bio tech corporation. It in no way follows the story of its predecessor apart from the fact that it has the same lead character in it. Who ever at capcom thought this was a good idea needs to be fired immediately. It just dosent make sence to me at all. What a truly disapointing sequel this has turned out to be. Total garbage Expand
  67. Mar 13, 2022
    9
    Some of my favorite horror games are games that make you go through a whole array of emotions, not just fear. The horror genre appeals to me because of that, and some of the best stories are those where the protagonist willingly chooses to go through a harrowing experience for the sake of those they love. This gives weight and purpose behind the scares, rather than just a game that's scarySome of my favorite horror games are games that make you go through a whole array of emotions, not just fear. The horror genre appeals to me because of that, and some of the best stories are those where the protagonist willingly chooses to go through a harrowing experience for the sake of those they love. This gives weight and purpose behind the scares, rather than just a game that's scary for the sake of being scary. By this definition, it's no secret Resident Evil Village is one of my all time favorite horror games.

    While others may disagree with me when I say this, but I think Resident Evil 7 was the perfect way for Capcom to not only revive the fear the Resident Evil franchise is known for, but to give it a personal story. Ethan Winters may not have been a character to stand on the same ground as Chris, Jill, Claire, or Leon, but he is an every man, a character that could've been any of us. Even his face is obscured or Mike Wazowski-ed to make it feel more like we've become a character in a Resident Evil game. In 7, Ethan doesn't have that much of a character or personality, but once Village comes along, we know exactly what kind of person he is, not only physically, but emotionally. In other Resident Evils, you fight off a hoard of zombies because you're either solving a mystery, fulfilling your duty, on an assignment, or some other obligation; in 7 and Village, Ethan is going into a hoard of of shapeshifting enemies for those he loves, adding a lot of heart into the series that it wasn't known for previously. While the story may not be the most special thing in the world, it's still a personal story about a father and going to the ends of the earth for his daughter, and that's something special. It reminds me of the original Silent Hill, another great horror game owing much to its personal story.

    As for the gameplay and visuals itself, a major throwback to Resident Evil 4. The gameplay is some of the best the series has to offer and the environments are diverse and fun to explore. I enjoy the variety of horror in Village, giving it more of a unique identity than standard body horror. There's gothic horror, psychological horror, suspense, and others to keep the game interesting and feels like you're fighting something different every time you enter a new part of the game.

    Resident Evil has come a long way, and while I wouldn't say Village is the best the series has done, it does give me confidence for the future. It convinces me that Capcom knows what they want to do with the series and they keep me waiting with bated breath for the next installment in my favorite horror game franchise.
    Expand
  68. Mar 10, 2022
    10
    This game embodies everything a Resident Evil fan like me wants. A great use of survival horror, jumpscares, conservation of items, creepy characters and awesome boss fights. It's a perfect summation of everything that works about Resident Evil as a series. It tweaks and embraces these elements, all packed into one efficient, engrossing and utterly horrifying set of challenges. ResidentThis game embodies everything a Resident Evil fan like me wants. A great use of survival horror, jumpscares, conservation of items, creepy characters and awesome boss fights. It's a perfect summation of everything that works about Resident Evil as a series. It tweaks and embraces these elements, all packed into one efficient, engrossing and utterly horrifying set of challenges. Resident Evil Village is definitely a huge contender for 2021 Game of the Year. Expand
  69. Mar 10, 2022
    9
    What a great game. Nice gameplay, engaging plot, stunning graphics and atmosphere. One of the best games of the year.
  70. Mar 9, 2022
    5
    + I liked the puzzle element of having to find the boss treasures after you defeated them
    + Shooting is alright even it feels like most guns are lacking "punch"
    + The final boss fight is pretty cool from a visual standpoint even if it feels like it's from a different game + The Chris section was fun + I liked the design of most characters + Graphically it looks really good - The
    + I liked the puzzle element of having to find the boss treasures after you defeated them
    + Shooting is alright even it feels like most guns are lacking "punch"
    + The final boss fight is pretty cool from a visual standpoint even if it feels like it's from a different game
    + The Chris section was fun
    + I liked the design of most characters
    + Graphically it looks really good
    - The story is really bad even by RE standards , It doesn't feel like Resident Evil , Ethan is still in between of being a character like any other and being an avatar for the player thus making him nothing and the pacing is erratic thus villains don't get the necessary screen time to be more memorable like RE4 for example where they had the codec calls
    - The cinematic/scripted sequences hurt the game incredibly and strip control away from you constantly . Plus they make replaying the game a pain
    - Boss fights are for the most part pretty bad
    - The tight FOV from RE7 didn't gel well with the over the top action
    - It's never scary or tense
    - There is hardly any audible music in a series known for it's music
    - Some nods were okay but the boulder thing was cringe . It was Capcom's "How do you do fellow kids" moment

    The overwhelmingly positive reception and the ending implications of this game leave me worried for the conclusion of the trilogy which to me might be even weaker than the RE4 to RE6 one . Village is not a bad game but merely an average one that tried to please everybody and ended up being passable in everything that it attempted to do
    Expand
  71. Mar 9, 2022
    10
    This review contains spoilers, click expand to view. Capcom has really created a top notch game and now this has set a benchmark for all FPS horror games according to me.
    Let's be honest by saying that capcom has redeemed itself with this game after the Resident Evil 3 Remake. I personally liked RE3 too.
    The visuals. Stunning. Breathtaking. It also maintains the atmosphere of the horror game. Trust me. You are going to find plenty of wallpapers in this game. It is absolutely beautiful.
    Coming to the gun mechanics, It is good and they did not mess around with it much keeping it simple and clean, like RE7.
    The story. Woah. Dislike this review if you did not cry, cause I cried, for 2 whole days.
    Now back to the overall gameplay. They absolutely smashed it. You will find parts where you need to use your wits, your accuracy (trust me, you're going to need this), also your courage (never have I ever played a resident evil game that is as terrifying as this one).
    Again, the visuals are absolutely beautiful.
    Expand
  72. Mar 8, 2022
    9
    this game have one of the best graphic and storys in games .everything is in hight quality.thank you capcom we want re9 very soon.
  73. Mar 6, 2022
    10
    بازی بشدت خوب و سرگرم کننده ای هست بشدت محیط های زیبایی داره عالی هست.
  74. Mar 5, 2022
    0
    just more of the same...
    repeat the same
    forgot his escense
    soo bad
    not recommended
  75. Mar 5, 2022
    8
    Nice megascans, in your face werewolf action and hanging out with tall creapy vampire lady.
  76. Mar 1, 2022
    10
    Excelente juego, lo gráficos están buenos, la historia interesante, los combates divertidos, el audio es excelente, aprovecha el dualsense muy bien.
  77. Feb 22, 2022
    8
    Sin duda un juego que deseaba que saliera pronto para poder continuar con la historia de Ethan, Afortunadamente pude jugarlo en su salida en una PS5 y debo admitir que los graficos mostrados y la fluidez del modo rendimiento hicieron un titulo muy disfrutable. La banda sonora fue muy buena y muy acorde a las situaciones presentadas, una de las partes que mas disfrute (una lastima que fueraSin duda un juego que deseaba que saliera pronto para poder continuar con la historia de Ethan, Afortunadamente pude jugarlo en su salida en una PS5 y debo admitir que los graficos mostrados y la fluidez del modo rendimiento hicieron un titulo muy disfrutable. La banda sonora fue muy buena y muy acorde a las situaciones presentadas, una de las partes que mas disfrute (una lastima que fuera corta) fue la casa Beneventto, terror puro y duro que me hizo recordar un poco de lo que senti al jugar el demo PT. Sin duda un juegazo que debes darle una buena oportunidad vale mucho la pena. Tengan la confianza de adquirirlo sin temor a decepcionarse. Expand
  78. Feb 22, 2022
    10
    Masterpiece game. The best part in the series. gameplay at the highest level
  79. Feb 21, 2022
    10
    Лучший хоррор 21 года. Леди Димитреску бесподобна! Очень жду длс и продолжение серии….
  80. Feb 20, 2022
    1
    Terrible game defiantly not even worth the sale price. The game mechanics are from the Stone Age and manages to make it even less fun than games with **** graphics. The story is not engaging and doesn’t make sense. At least with re7 it was on psvr so it had that going for it but now all the scares I’ve seen so far fail to deliver even harder except for the jumps your not expecting but ITerrible game defiantly not even worth the sale price. The game mechanics are from the Stone Age and manages to make it even less fun than games with **** graphics. The story is not engaging and doesn’t make sense. At least with re7 it was on psvr so it had that going for it but now all the scares I’ve seen so far fail to deliver even harder except for the jumps your not expecting but I could care less about jump scares. Bth I haven’t played all the games in the series but I enjoyed re7 for what it was. Re8 lost my interest so quick with the gameplay and I’m baffled anyone so many could find enjoyment from it especially when you can’t even properly aim down a sight which is a core mechanic. Expand
  81. Feb 20, 2022
    10
    Que jogo maravilhoso, como não sou saudosista eu adorei o jogo, os cenários são maravilhosos da vila á fábrica, a história tem uma dinamica boa embora tenha seus cliches, o duque é sensacional, e o Ethan teve um final digno.
  82. Feb 20, 2022
    8
    Very good game !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
  83. Feb 20, 2022
    9
    Not as frightening as Resident Evil 7 but still has some great scares and atmosphere. Graphics, sound and all technical aspects are top notch. It's a real AAA game. The character designs are wonderful. Chris looks much better than he did in 7. There's more action in this game than 7 but it doesn't go into RE4 territory which is good. Hopefully they keep this balance for the next one. JustNot as frightening as Resident Evil 7 but still has some great scares and atmosphere. Graphics, sound and all technical aspects are top notch. It's a real AAA game. The character designs are wonderful. Chris looks much better than he did in 7. There's more action in this game than 7 but it doesn't go into RE4 territory which is good. Hopefully they keep this balance for the next one. Just better than 7 but not as good as RE2: Remake. An amazing game. Expand
  84. Feb 19, 2022
    10
    I was really let down by what they did with RE3R, but this almost made me forget all that.
    Similar to RE2R, you can feel the amount of care and passion put into this game. I really liked the gameplay, the story, and the performance (provided you turn off the ray-tracing). I have no problem saying I like this game almost as much as RE4. To put into perspective, this is my top 5 for RE
    I was really let down by what they did with RE3R, but this almost made me forget all that.
    Similar to RE2R, you can feel the amount of care and passion put into this game. I really liked the gameplay, the story, and the performance (provided you turn off the ray-tracing). I have no problem saying I like this game almost as much as RE4. To put into perspective, this is my top 5 for RE games:
    RE4, RE8, RE2R, RE1R, RE7
    Expand
  85. Feb 17, 2022
    2
    This is the worst game of this franchise capcom came up with. 7 was a promising restart of the series, but they failed this one, the classic late resident evil **** again ruined everything again
  86. Feb 16, 2022
    10
    Отличная игра !! Интересный сюжет. К тому же я соскучился по качественным и хорошим играм и по харизматичных персонажах без всякого этого говна типа: феминизм, всякие там меньшинства.... Японцы молодцы!! В каждой игре есть конечно свои недостатки , но в этой игре я получил хорошие эмоции и главное - мне было интересно в нее играть.Отличная игра !! Интересный сюжет. К тому же я соскучился по качественным и хорошим играм и по харизматичных персонажах без всякого этого говна типа: феминизм, всякие там меньшинства.... Японцы молодцы!! В каждой игре есть конечно свои недостатки , но в этой игре я получил хорошие эмоции и главное - мне было интересно в нее играть.
  87. Feb 16, 2022
    8
    I did not play the 7th part, as I was disappointed with the transition to the 1st person view. But I decided to try the 8th part. I liked the game.
    Pros: The game has a beautiful design and style. Nice graphics. Interesting to explore the world. Interesting trade. Good plot and characters.
    Cons: No 3rd person view. It gets boring towards the end.
  88. Feb 15, 2022
    10
    Единственные, кто в этом году меня из ААА - студий не разочаровал. Так держать. Только на японских игроделов в последнее время и можно рассчитывать. Европа и Америка - одно только разочарование. Ставлю 9 балов + 1 за то что кроме этой игры больше НЕ ВО ЧТО В ЭТОМ ГОДУ ИГРАТЬ!!!Единственные, кто в этом году меня из ААА - студий не разочаровал. Так держать. Только на японских игроделов в последнее время и можно рассчитывать. Европа и Америка - одно только разочарование. Ставлю 9 балов + 1 за то что кроме этой игры больше НЕ ВО ЧТО В ЭТОМ ГОДУ ИГРАТЬ!!!
  89. Feb 14, 2022
    8
    The game was a really really good game and definitely had some scary things about it especially the monster that attacks you. Graphics are also pretty awesome too and and very entertaining. The only issues I have with this game is it felt like the theme kept changing going from scary tall lady(Lady Dimistrescu), to ghost hallucinations(Beneviento), to monstrous sea monsters(monreau), andThe game was a really really good game and definitely had some scary things about it especially the monster that attacks you. Graphics are also pretty awesome too and and very entertaining. The only issues I have with this game is it felt like the theme kept changing going from scary tall lady(Lady Dimistrescu), to ghost hallucinations(Beneviento), to monstrous sea monsters(monreau), and a factory with machine monsters( Heisenberg). Some levels didn't feel like true Resident Evil survivor horror I don't like the idea of ghost hallucinations in resident evil nor dolls being possessed, that more for games like silent hill or outlast....Resident evil is about poeple getting infected with a virus and changing into bioweapons not silly unbelievable ghost hallucinations also just wish some things were explained more as for as the story but overrall really good game that stayed true to the RE formula besides the beneviento level. Expand
  90. Feb 14, 2022
    9
    Buenísimos como siempre,gran historia y mejor final la temática recuerda a películas de los 90 un gran toque.
  91. Feb 12, 2022
    10
    The one of the best part of resident evil after that resident evil 4 I played enemies and boss fights and atmosphere more scary than RE7
  92. Feb 9, 2022
    10
    es un buen juego lo recomiendo mucho la saga Resident Evil vuelve a su survival horror y es lo que me encanta de este juego.
  93. Feb 9, 2022
    0
    This game was not even remotely scary. This game sucked. It might be the worst RE to date, havent polish
  94. Feb 8, 2022
    0
    No polish language. No polish language. No polish language. No polish language.
  95. Feb 6, 2022
    8
    Big Booba
    Big Booba
    Big Booba
    Big Booba
    Big Booba
    Big Booba
    Big Booba
    Big Booba
  96. Feb 4, 2022
    9
    I finished this game yesterday, played 4 days with my wife, and came here just to say thank you to the developers for the time I spent in this game. Amazing! Thank you! With love from Russia!
  97. Jan 24, 2022
    10
    Good

    - A good follow up to RE7 story - The presentation is virtually flawless. - huge improvement on the variety of enemies in the game, compared to the repetitive black sludges in RE7. - the villains are interesting af. - The themes were varied, from spooky to disgusting and everything in between. - Chris' appearance is back to normal - More tie in with original story
    Good

    - A good follow up to RE7 story

    - The presentation is virtually flawless.

    - huge improvement on the variety of enemies in the game, compared to the repetitive black sludges in RE7.

    - the villains are interesting af.

    - The themes were varied, from spooky to disgusting and everything in between.

    - Chris' appearance is back to normal

    - More tie in with original story like Chris, Umbrella, and BSAA

    - Funny merchant

    - puzzles were not too complicated and pretty interesting for the most part.

    - weapons feel great to use. The amount of ammo had the right level of scarcity

    - the environment design was fantastic

    - the voice acting, camera control, and the character movements were great

    Bad

    - really small things. Like a bullet being able to knock a lamp into full swing is unrealistic making the puzzle a little hard to figure out. There was one part where yellow paint was misused tractor shovels in the ventilation in the factory, making me confused as to where to go.
    Expand
  98. Jan 23, 2022
    1
    The game is just great! The plot is addictive, the management is generally pleasant, in some parts it's creepy. Passed 4 times to collect all the trophies (played on PS4)! BUT!!! Why was it necessary to go through the stupid S-rank mercenary mode to get platinum????? Only because of this low score!!!
  99. Jan 20, 2022
    9
    This game is Amazing I Like it, Great story great gameplay, the movement was not good enough
  100. Jan 15, 2022
    9
    Amazing. Like it's f*cking incredible. The atmosephere, attention to detail and design of everything is on masterpiece level.
  101. May 8, 2021
    10
    Let's be honest, Capcom did the excellent work overall.
    Creepy atmosphere is totally leaking out from the screen and this is what people love.
    Beautiful visuals, amazing depressing sounds and freaky story forces me to keep playing.
    Strongly recommend to everyone!
Metascore
84

Generally favorable reviews - based on 108 Critic Reviews

Critic score distribution:
  1. Negative: 0 out of 108
  1. CD-Action
    Dec 7, 2021
    90
    Similarly to Resident Evil 4 back in the day, Village will attract a new generation of players and redefine the franchise for the modern age. I guess it’s time to stop looking back and counting on the series to return to its roots. Capcom is well aware of those roots and willingly draws from them to create something new but still infused with Resident Evil’s spirit. Village is not perfect, but neither was RE4, and once again it’s easy to turn a blind eye to the flaws, because overall it’s an amazing game. [07/2021, p.56]
  2. Nov 22, 2021
    90
    Resident Evil Village feels like such a culmination. Bringing together elements from the franchise all the way up to now and crafting what looks to be the next step of survival horror, it embraces every aspect of the franchise. While the insidious dread of Resident Evil VII is missing, there are still plenty of scares. The monster designs are fantastic, from the generations undead, the fury of the Lupine beasts, to the towering monstrosities. It's well worth delving into the concept art and 3D models to enjoy them fully. The story is just the right amount of silly with the terrifying, and the odd dash of the surreal. The combat is smooth and fluid, best evidenced in the addictive Mercenaries mode. All of these elements added together make quite possibly the best Resident Evil to date, and a foundation for a fresh new generation of terror.
  3. Jun 8, 2021
    80
    RE: Village is a mixture of almost all previous Resident Evil elements, making the most of both survival horror and puzzle intensity, but with the primary stage being left for the more action-like nature of Resident Evil 4. It has some great story moments, sprinkled with a few lacklustre characters that are still overshadowed by its most notable characteristic – most detailed environment to date.