Grand Theft Auto III

 PlayStation 2
User Score
8.4

Generally favorable reviews- based on 1185 Ratings

User score distribution:
  1. Positive: 953 out of 1185
  2. Mixed: 150 out of 1185
  3. Negative: 82 out of 1185
Buy Now
Buy on

Review this game

  1. Your Score
    0 out of 10
    Rate this:
    • 10
    • 9
    • 8
    • 7
    • 6
    • 5
    • 4
    • 3
    • 2
    • 1
    • 0
    • 0
  1. Submit
  2. Check Spelling
view
per page
  1. Alex_Pilgrim008
    Apr 2, 2023
    9
    "Grand Theft Auto III" revolutionized the video game industry with its introduction of the 3D open world. At the time of release, it was highly controversial since it allowed players to engage in all sorts of major criminal activities. Nevertheless, GTA III was a huge hit and has been named one of the greatest video games ever made by several critics. This is a satirical action-adventure"Grand Theft Auto III" revolutionized the video game industry with its introduction of the 3D open world. At the time of release, it was highly controversial since it allowed players to engage in all sorts of major criminal activities. Nevertheless, GTA III was a huge hit and has been named one of the greatest video games ever made by several critics. This is a satirical action-adventure influenced by Hollywood mob films. It's a tasteless guilty pleasure meant for a mature audience. Great wicked fun. Despite its flaws, this is the first GTA that set up the template for future entries and inspired countless of open-world games. I would rate it with a 9.6 out of 10.… Expand
  2. LasPlays
    Mar 1, 2018
    9
    Bueno que decir de una de las sagas mas famosas del mundo mundial, alguien que no haya escuchado sobre GTA en la actualidad no es un gamer.
    Este fue el primer juego de la saga que se puso en 3d y en tercera persona, ya que las dos entregas anteriores se veía desde arriba, no se muy bien como se le llama a ese tipo de genero de videojuegos.
    En la radio hay bastante variedad para escuchar    Bueno que decir de una de las sagas mas famosas del mundo mundial, alguien que no haya escuchado sobre GTA en la actualidad no es un gamer.
    Este fue el primer juego de la saga que se puso en 3d y en tercera persona, ya que las dos entregas anteriores se veía desde arriba, no se muy bien como se le llama a ese tipo de genero de videojuegos.
    En la radio hay bastante variedad para escuchar y el juego en historia por lo menos a mi me lleno, no quiero comentar mucho sobre eso porque no quiero que allá Spoilers.    … Expand
  3. md5fungi
    Jan 5, 2019
    9
    Grand Theft Auto III is an extremely ambitious attempt to bring the series' ultraviolent mayhem to the 3D world for the first time. In 2001, no one yet had really tried making a game like it, with the exception of Driver, which was an intense chase game with less grandiose expectations for itself than GTA III.

    You play as the silent Claude, a recently escaped prisoner who ends up taking    Grand Theft Auto III is an extremely ambitious attempt to bring the series' ultraviolent mayhem to the 3D world for the first time. In 2001, no one yet had really tried making a game like it, with the exception of Driver, which was an intense chase game with less grandiose expectations for itself than GTA III.

    You play as the silent Claude, a recently escaped prisoner who ends up taking all sorts of dirty jobs around town. Even though Claude doesn't say anything or really have much of a personality (I suppose you get to choose what kind of person he is), the other characters in the game do. Most everyone you meet has a few screws loose and is up to no good. The darkly humorous exchanges you'll have with these characters adds to the atmosphere and style of the game.

    The main premise of GTA III is that you wander around a living, breathing world in which any car is free for you to take (though not necessarily with the blessing of the owner or police). There are no rules.

    There are a lot of different vehicles in the game, and they all drive differently as well. You can drive a blazing fast sports car or a dangerously heavy-duty fire truck (with which you can spray out fires, or just harass pedestrians with the hose). Almost everything is fun to drive, thanks to a solid physics engine. Your car will realistically spin out of control when a cop rams you, and when you're going fast, you FEEL it.

    Even if you're going for a relaxing drive across the incredibly immersive city, cruising is still fun thanks to the ability to listen to a variety of in-game radio stations. There's hip-hop, 80s pop, classical, and more, and a lot of the stations are straight-up infectious. Listening to talk shows or radio DJs is hilarious, due to the care Rockstar has put into the pervasive satire and dark comedy of this game. I found myself laughing a lot when I first started playing. The game does irreverence perfectly.

    GTA III has missions scattered around the city for you to find. Most of the missions involve driving around town, often killing rival mob members. While the third-person shooting mechanics are much more difficult and clunky than most first person shooters from this era, the ridiculous, over-the-top violence makes it tolerably satisfying. You can easily dispatch other characters into bloody corpses on the streets of Liberty City. If you lose all your health, you end up outside the Liberty City hospital - a nice touch. This game is full of little touches that improve immersion.

    While the game's missions are straightforward, there's a lot of freedom when it comes to approaching them. You may choose to kill a target with a grenade... but then there's the Uzi... or perhaps, just run him over a few times for good measure. The game gives you multiple options, and the missions are usually a lot of fun (especially when they involve explosives). The unfortunate aspect about the missions materializes when you fail them: you are forced to find the mission giver again, and go through the entire process. This starts to get annoying quickly, especially as many missions will have you driving all over town. The missions are hard enough that you will be going through a lot of retries to beat them, but luckily there are nearly always multiple missions to choose from.

    Another problem with the missions is that you frequently need to quickly get to locations that aren't on your map. A paint shop that disguises your car is extremely useful when the cops are on your tail, but where is that shop again? Leaving these locations unmarked makes these situations frustrating.

    The amazing thing about GTA III is the freedom. The tools it gives you to cause mayhem are varied, and you can get pretty creative with all the options. Sure, you can go to the gun shop and buy something, but you can also equip your car with a bomb. Maybe you feel like stealing a vehicle and throwing it into a trash compactor. The game continually reveals differing means of destruction, and then let's you use them as you like, even if you have no goal in mind. If you really feel like being a productive member of society, you can charge cab fare to take people to various locations or put out fires with a fire truck. This truly is an open-world video game.

    Besides your chaotic influence, computer-controlled cars will ram into each other, gang members will start shooting, and the game generally does a fantastic job of convincing you that it's real while making fun of the real world at the same time.

    Rockstar created a dense, smart, cool, and awe-inspiring world with Grand Theft Auto III, and it still shows today.    … Expand
  4. Flashyboy89
    May 19, 2023
    9
    GTA 3 was a groundbreaking achievement in gaming history that was so fresh. It blew everybody's mind back in the day.
  5. Soldier1stClass
    Jul 23, 2020
    9
    When I was younger GT3 blew my mind when it 1st came out. It was my 1st experience with the GTA franchise and the game was an amazing product for it's t's time. I still play it every once in awhile.
  6. Ardho
    Aug 30, 2021
    9
    The game is so good, that other games feel outdated, what a big step for the game world
  7. CloudStrife05
    Aug 21, 2021
    9
    And the world was never the same again... That is what should be said whenever talking about GTA3.
  8. Jattaman
    Oct 3, 2022
    9
    Il terzo capitolo rivoluziona la serie con il 3D.
    Perde l'originalità e la crudezza del primo episodio, ma stravolge in positivo per impatto grafico, giocabilità e maestosità del progetto.
  9. Runatikku
    Feb 1, 2022
    9
    This game is a groundbreaking game in the gaming world. I remember my brain stopped the first time I played it. I don't remember any game I've played before that gave me so much freedom. And the graphics, oh my god, my eyes melted when I saw the graphics of GTA 3, which had spent my life with NES games until then. The game I begged my family to buy a ps2. Generally speaking, it is not theThis game is a groundbreaking game in the gaming world. I remember my brain stopped the first time I played it. I don't remember any game I've played before that gave me so much freedom. And the graphics, oh my god, my eyes melted when I saw the graphics of GTA 3, which had spent my life with NES games until then. The game I begged my family to buy a ps2. Generally speaking, it is not the strongest game in the GTA series, but we have to accept that it is the game that started the legend. As I said, the graphics are very good for its time, the gameplay is also the same, even today I think it's still comfortably playable, the scenario is not very good, it's a classic revenge story, but because Claude is a total dull, he can't make us feel this feeling of revenge. Other than that, freedom, stealing cars, entering cheat codes, and attacking people are all as expected from a GTA game. I think it's a game that everyone should experience. The missions are generally pretty easy and short with a few exceptions. So I suggest you give it a try.… Expand
  10. DanThePerson
    Aug 27, 2022
    9
    once again this game has a cool premise and atmosphere, and bunch of other cool stuff, and the music/radio stations are one of my favorite things about the game.. but there's a inconsistent difficulty yet again, and also yet again it caused me to never beat this game.. I guess maybe the older a GTA game is, the harder it becomes..
  11. dr-kenobi
    Sep 6, 2022
    9
    The case when the first real try is not a mess, but a huge hit. Truly the origin of the future best seller of the gaming world
  12. 3ls0ul
    Mar 6, 2023
    9
    Este juego aún no lo eh jugado o completado, así que pondré una reseña y nota diferentes cuando lo haga.
  13. Yojimbo2015
    Jul 28, 2023
    9
    Inevitably a little simplistic and crude compared to the later incarnations and some of the missions are frustratingly difficult thanks to the combination of dodgy AI and vehicles that are far too fragile, but it was a game changer at the time and was the genesis of the modern sandbox game.
  14. Warrior_of_Doom
    Jul 19, 2023
    9
    The overall score is based on how much fun I personally had with every component of the game
    and the overall experience.
  15. VLG
    Aug 22, 2023
    9
    What can i say that has not been said a thousand times. Despite its obvious old age and crappy graphics, I have such good memories about it.
  16. B.S.
    Oct 8, 2002
    8
    You know what I hate people using critic sites like this as a chat room, so I'm not replying to any messages! there is a fourth city but it has nothing to do with a black smith! The graphics are shooty and the game has a cumple glichs other than that it's perfect ( and I should know I'm a real hard ass).
  17. SquirtB.
    Nov 6, 2004
    8
    Dyam.This Game Is F-ed Up Good.Although Having To Feed The Character Every Once In A While Is Quite Annoying,But Overall Its Good.Story Line Is Great.Graphics Are Neutral.Met Up To My Expectations.But They Really Have To Do Something About Those Ugly Characters Of Theirs.Well,Basically.This Game Is Definitely Worth Playing.
  18. AndrewD.
    Oct 9, 2004
    8
    Doesn't get 10 from me because it gets a bit repetitive (kill that guy, run from cops,etc...) and I think that the fisrt island gets boring after being stuck on the same mission on shoreside vale for 1 month.
  19. JasonB.
    Nov 16, 2005
    8
    The criminal underworld backdrop is always fun to have as a storyline, but the gameplay of GTA 3 is fun with or without it.
  20. JohnS.
    Feb 24, 2007
    8
    This game is pretty good, but not perfect. Good use of open-endedness though. Cool Am Ivan, there is no Boggsville. Theres a ghost area that was used for the opening act of GTA 3, but it isnt solid and can be gotten there by dodo going north of shorside vale. There is no blacksmith and no swords and no boss battle there. Don't believe this liar. And the game doesn't suck, either.
  21. Jack97
    Jan 1, 2014
    8
    Grand Theft Auto 3 was a huge leap forward for videogame history as it featured one of the first fully 3D open world environments and a good story mode.
  22. joao1198pedro
    Oct 30, 2013
    8
    the two firsts gta games were nothing special,but in the third game and with another generation they made something really special and terrific,this game would change this series forever.
  23. VALVeY
    Nov 18, 2014
    8
    THIS GAME IS SO AWESOME ! The only thing I complain about is the controls other than that this game is awesome ! It has cool graphics great gameplay and variety for weapons ! GET THIS GAME ON THE PSN
  24. Scytherax
    Aug 15, 2014
    8
    This review contains spoilers, click expand to view. Grand Theft Auto III is one of a kind. With a 3D and 2D Third Person View, epic artwork for the Heads Up Display and 3D models like no other in the time, Grand Theft Auto III has nailed the best Graphic Design I have ever seen that comes from the year it was made. Sure, there are other good designs like the Elder Scrolls at the time but the artwork on the box and in game makes me go "Holy f*ckin' ****

    The gameplay has again, a 3D and 2D Third Person View, making this as view-customizable as Fallout. The free roam is quick but locked places can take time to UNlock the locations. Although there aren't many character customization options (-1), there is quite an array of weapons available to the player. Unlike San Andreas, it was a shame that the game had a garage without any modification options, making the vehicles barely customizable (-1).

    However, I like the way when you kick someone, you actually get money unlike the nowadays Grand Theft Auto where it automatically drops out of the victim's wallet after being killed. Not to mention geting stacks of money only worth up to $50.

    Grand Theft Auto III will always be one game withing my heart, even in this year of 2014.    … Expand
  25. DailySalesman
    Mar 22, 2015
    8
    The days before Grand Theft Auto became a world of sexual themes was certainly a good one even if I am now shaking my head at the amount of strong language featured here. The graphics here are a bit under par if I do say so myself but the gameplay itself is top notch. Grand Theft Auto III is quite simply put a fun romp through a huge city. It's incredibly innovate yet outlandish at theThe days before Grand Theft Auto became a world of sexual themes was certainly a good one even if I am now shaking my head at the amount of strong language featured here. The graphics here are a bit under par if I do say so myself but the gameplay itself is top notch. Grand Theft Auto III is quite simply put a fun romp through a huge city. It's incredibly innovate yet outlandish at the same time and that is what defines GTA.… Expand
  26. Duke_Nukem
    Sep 30, 2015
    8
    When the game Grand Theft Auto (1997) came out on the original Playstation, it was an amazing game but with a top down view which I really didn't like. A few years later the amazing game Driver (1999) came out and I remember how impressed I was with that game's freedom to drive anywhere you want in the city in full 3D! Then came GTA III for the PS2, which combined the excellent gameplay ofWhen the game Grand Theft Auto (1997) came out on the original Playstation, it was an amazing game but with a top down view which I really didn't like. A few years later the amazing game Driver (1999) came out and I remember how impressed I was with that game's freedom to drive anywhere you want in the city in full 3D! Then came GTA III for the PS2, which combined the excellent gameplay of GTA with the 3D view of Driver.

    The graphics and sound were great for that time. I loved the many radio channels in the car (opera music!).
    The camera position was sometimes annoying; I particularely didn't like how the view changed to first person view when you wanted to look around. The controls were decent but a lot of times i was shooting at another person than the one i intended to shoot.

    The game has aged quite well and is still a lot of fun to play, but it was surpassed in every way by its successors GTA Vice City and GTA San Andreas.

    I didn't like the dark and gloomy colors of GTA III, it looked like it was dark and raining almost all the time. GTA Vice City threw the darkness out of the window and chose for bright colors. GTA San Andreas added the great multi-player option for two gamers on one screen, swimming, more vehicles and planes etc... but GTA III was the game that made the first step towards the title of best game series in the history of gaming.

    For that reason I rate this game 8 out of 10.    … Expand
  27. SSJGodku
    Jul 18, 2023
    8
    This was my introduction to the GTA series. I enjoyed the story & characters. I also liked just driving around and reeking havoc on the civilians.
  28. tomflanders
    Dec 3, 2021
    8
    Groundbreaking game and decent storyline. Would definitely recommend for those who haven't played a GTA before
  29. MicroscopicMoon
    Jan 12, 2019
    8
    The best part of the series, the atmosphere of real city. The main character is like a hipster, but in fact it is a very charismatic character.
  30. hundead309
    Jun 1, 2020
    8
    I know that this was one of the gtas and one of the most important games in the world, but unfortunately it has aged a lot, not only in the graphics that were a little out of date for the time, but also in the very slow and primitive gameplay. In addition, he is very difficult, seriously, he must be one of the most difficult gtas I have ever played, missions like "bomb base 2", "expres 2I know that this was one of the gtas and one of the most important games in the world, but unfortunately it has aged a lot, not only in the graphics that were a little out of date for the time, but also in the very slow and primitive gameplay. In addition, he is very difficult, seriously, he must be one of the most difficult gtas I have ever played, missions like "bomb base 2", "expres 2 go" and "SAM" are almost impossible and I couldn't finish this game without codes.… Expand
  31. Raymond86
    Dec 7, 2022
    8
    The original open world sandbox game. 21 years after it's release GTA III holds up and is just as playable today as it was then.
  32. Lyralei3
    Feb 26, 2023
    8
    GTA III - самая недооцененная часть гта и самая жестокая гта с хорошей атмосферой
    Оцениваю игру на 8/10
  33. grimreapersims
    Sep 9, 2021
    8
    ....................................................................................................................................................................................................blank
  34. DonldTrump_45Th
    Jan 26, 2023
    8
    Hello, this is a default review because i'm forced to use 75 characters. I'll edit this review in the future talking about the game, don't worry ;)

    My final rate is: 8
  35. Uauqdemais
    Dec 28, 2022
    8
    O começo de algo pica, mas não é nem de perto perfeito. A gameplay é datada, sendo o principal problema deste jogo.
  36. SuperDude
    Feb 11, 2002
    7
    It is a really great game, it's just that I can't seem to wanna play it more and more. When I get killed or busted I just feel like quiting.
  37. AndyS.
    Dec 29, 2004
    7
    This is definitely a great game, but when it comes to the story, just like the other GTA's, it's not to addctive. All in all, the gam is good, but it needs more color. Comparing it to the new GTA's, Vice City, as well as San Andreas, it doesn't even make a 6.5.
  38. JesusC.
    Oct 9, 2007
    7
    It's a decent game, but it's also a little stale a little more than 4 hours in.
  39. MikeB
    Dec 29, 2009
    7
    This was a good game considering the time it was made. GTA 3 can't be compared to GTA SanAndreas or GTA4, because of graphics and range of vehicles, and weapons. People who are saying it is bad are most likely comparing it to brand new games. If you compare it to games that were made in that time period, you will probally find it is a good game. It could use some work though, like This was a good game considering the time it was made. GTA 3 can't be compared to GTA SanAndreas or GTA4, because of graphics and range of vehicles, and weapons. People who are saying it is bad are most likely comparing it to brand new games. If you compare it to games that were made in that time period, you will probally find it is a good game. It could use some work though, like your character doesn't even talk in GTA3.… Expand
  40. DaBlackNight
    Mar 10, 2012
    7
    This Game Is Alright For Gamers. I Would Rather Play This Game If I Had Nothing To Do Though. But It Is A Good Game. i Just Wish The Voice, Sound And Lighting Would Improve.
  41. Speed4Runs
    Dec 16, 2012
    7
    Amazing game. Good graphics and big city, for its times, and very good plot. The gameplay is great because you can do a lot of things (although it isn't even comparable to GTA San Andreas). 100% recommended.
  42. Cmmcfreire
    May 7, 2020
    7
    Story - 7/10
    Gameplay - 7/10
    Graphics - 7/10
    Soundtrack - 7/10
    Levels - 8/10
    Replay value - 7/10
  43. PresidentTrump
    Oct 28, 2017
    7
    After getting this pain-in-the-ass of a game to start, the ass pain didn't stop.
    The resolution was garbage and alt-tabbing out of the game took forever.
    I installed the silent patch and some other gameplay fixing mods. Now the pain can stop. For now. The story: A guy named Claude gets shot by his girlfriend while robbing a bank. He's arrested but breaks out with his boy 8-Ball.    After getting this pain-in-the-ass of a game to start, the ass pain didn't stop.
    The resolution was garbage and alt-tabbing out of the game took forever.
    I installed the silent patch and some other gameplay fixing mods.
    Now the pain can stop. For now.

    The story:
    A guy named Claude gets shot by his girlfriend while robbing a bank. He's arrested but breaks out with his boy 8-Ball. Claude works up the ranks trying to make money and find Catalina. He works for the Mafia, the Yakuza, and others. He eventually finds Catalina and shoots her down out of her helicopter and Claude walks off with his new girl, Maria.

    The gameplay:
    Some clunky driving. Horrible driver AI since they crash into you constantly because they switch lanes with no warning.
    Bad Shooting. The game is heavily outdated. Most missions suffer because of this. It's either the driving or the Cartel mows you down with their M16 that will kill you in a literal second.

    The graphics and cinematics:
    The graphics in GTA 3 are meh. The game is 15 years old (holy sh*t) so the graphics aren't going to be that great. Even though, the game still looks good. If you get the resolution fix mod, the game looks less pixeled and you can experience the game PS2 style. The cinematics and cutscenes are alright. Although it feels really awkward when Claude walks into this guys house, he tells Claude what to do, and Claude just nods his head after doing so. Claude has no real interaction with characters, which makes them feel flat. Only in missions where two other characters interact, is where the dialogue writing shines.

    Soundtrack:
    Most of it was awful to me. I'm the type of guy that can listen to mostly anything, so that's a lot. I liked Game FM and Flashback. The Jamaican and classical music didn't fit the environment and got annoying. Even on stations, I liked, there were only 6 or so songs. So you're constantly hearing that one song that goes "We're gon give this all that we gooot, keep on risin to the top!" and it gets really annoying. Most of the time I actually just listen to Lazlow talk about stupid sh*t.

    The missions from hell:
    The last about 10-15 missions are so ball burstingly hard, I almost skipped this game and went to Vice City.

    -Donald Love's Missions - Liberator
    Save some old dude from Cartel. Sounds easy until they tear you apart with M16s.
    Donald's Mission - Waka-Gashira Wipeout
    Kill Kenji, a leader of the Yakuza gang (also the guy you worked for) to start a gang war between Yakuza and cartel. You can't leave your car (since it's a cartel car and your identity will be revealed if you leave) so if the car is on fire, it's over. They shoot at your car with M16's which will destroy it in seconds, while you must drive by ONE GUY and if you fail to hit him, it's over.
    Donalds Mission - A Drop in the Ocean.
    Pick up some packages that a plane drops, while each package gives you one star. There are 6 packages. The boat controls are clunky and the water feels really weird. And when you're driving to the paint n spray (THAT ISN'T MARKED ON THE MAP) you're getting rammed with FBI cars and SWAT trucks.
    Donald's Mission - Grand Theft Aero
    Guess what, that last mission didn't matter. It was just a decoy, lol. Drive to another island you've never seen before, then drive back to the other island and kill Cartel members armed with M16 that will kill you damn near instantly. They're hiding around tight corners and the **** aiming doesn't help.
    The rest of Donald's mission isn't bad, Akuza's is though.
    Akuza's mission - Bait
    You drive around the new island, leading Cartel death squads to a Yakuza hid out so they're killed. Yeah, except the Yakuza are garbage and you have to kill them yourself at the death squad, or else they get away.
    Akuza's mission - Espresso 2 Go!
    One of the hardest in the series, trust me I've played them all.
    You drive around THE WHOLE MAP in 7 minutes. AND THERE IS NO FULL MAP ONLY A MINI MAP AND YOU HAVE TO DRIVE AROUND BEFORE DESTROYING THE COFFEE STANDS BECAUSE THEN THE MARKERS DON'T SHOW UP F*CK THIS MISSION!
    Akuza's Mission - S.A.M
    Another one of the hardest in the series. You blow up a plane mid-air in a boat. You have to STOP the boat. And aim your rocket launcher, if it misses, tries again. Or you could cheat in a tank and blow the cartel and police to Kingdom f*ck and get it over with.

    But what there's more!:
    There are some nice side missions in GTA 3 that are nice. Hidden Packages that give you weapon pickups outside your safehouse per 10 collected out of 100. The map is small and easy so it's now that bad.
    Paramedic - Pick people up and drive them to the hospital in a timelimit, and you can't crash. If the Mafia hates you, good f*cking luck since now they got shotguns that blow you to kingdom f*ck.
    Do I recommend the game?
    Yeah. As much as I hated the end missions, I had fun getting the collectibles and a lot of the earlier missions. I recommend on sale or even at its normal price    … Expand
  44. Br_AgSs
    Apr 12, 2020
    7
    GTA iii was a revolucionary game, except, it didnt aged too well. The game has an ok story, the driving system is nice and the graphics were the best of 2001, Claude is a cool character even though he doesn't talk, makes him look cold. But, playing it in 2019 is a bit weird, the combat is very hard, and the car is very weak, still, a great game.
  45. Deathbringer_01
    Feb 19, 2020
    7
    GTA III foi uma experiência legal que tive na era do PS2, mas o jogo pra mim não é lá dos seus melhores, sinto que ele envelheceu muito mal e com razão, o jogo possui algumas missões bizarras ao estilo GTA mas existem exageros na polícia e em outras missões, os carros tem uma dirigibilidade péssima, mas é divertido.
  46. donkaapo
    Sep 15, 2022
    7
    blank..........................................................................................................................................................................................
  47. ElKooi
    Aug 31, 2023
    7
    Graficos para su epoca: 7/10 los personajes les faltan dientes y tienen manos con dedos pegados
    Jugabilidad: 8/10 un apuntado automatico porque aun no habian juegos que adapten bien los shooters en consolas asi que fue bien implementarlo
    Mapa: Mundo abierto 9/10
    Misiones: 7/10 estan entretenidos

    El juego esta bueno pero envejecio mal por sus posteriores entregas por eso un 7
  48. Fdmint
    Nov 6, 2004
    6
    Someone said the game is pointless ... yeah ..why doesn`t Fido just runs away with Maria ..an live happily ever after ???? ...AND MY Question : What ever happened with 8-Ball the demo-expert , "your' friend ?....and the 3 cities are very big U move very slow betwen them ...AND : I was told that there was no 4-th city !!!!!!!! or somebody was talking about that ghost city { wich is an Someone said the game is pointless ... yeah ..why doesn`t Fido just runs away with Maria ..an live happily ever after ???? ...AND MY Question : What ever happened with 8-Ball the demo-expert , "your' friend ?....and the 3 cities are very big U move very slow betwen them ...AND : I was told that there was no 4-th city !!!!!!!! or somebody was talking about that ghost city { wich is an error ? right ? } ...and I like the shot-gun..but it`s to ...i mean U can destroy a car with only 2 shots ...thats to much !!!! AND Another of my Questions : What happened with Donald Love ?? I mean in the last of his mission..that`s just a cut-seen ..he dissapears !!!..where does he go ? and why does he leave ?? … Expand
  49. PeteM.
    Dec 22, 2001
    6
    Great game but the graphics are to jerky when u drive around. Should have been done better!
  50. LouisM.
    Aug 20, 2006
    6
    Mediocre. I picked it up after having much experience with GTAs 1 and 2, with high expectations. The environment is detailed, varied, interesting, and with passable interactivity. There's a wonderful variety and sufficient volume of music included. The missions, however, are abysmal. Perhaps the worst I have ever seen in a game. Almost all are incredibly formulaic, and amount to "go Mediocre. I picked it up after having much experience with GTAs 1 and 2, with high expectations. The environment is detailed, varied, interesting, and with passable interactivity. There's a wonderful variety and sufficient volume of music included. The missions, however, are abysmal. Perhaps the worst I have ever seen in a game. Almost all are incredibly formulaic, and amount to "go to these locations with this time limit". Some missions must be thoroughly scoped (i.e., memorizing the positions of all important locations you must visit) and thus retried many times before victory is even possible, which to me seems ludacrous. Also, I'm very fond of GTA2, so I think the "respect" system and choice of gang you show your allegiance to was much more effective and advanced than the mission structure of this game, which is far more linear. Also, skirmishes between gangs on the streets do not occur often enough. Having to go through enemy territory on certain missions while being shot up is incredibly frustrating, given the already often excessive difficulty. The mechanics (especially shooting) are poorly designed and frustrating. Also, the inability to simply start a mission again from the beginning with the same equipment is bizzare. It's an okay game on the whole, but was and still is incredibly overrated and overappreciated. I really don't see how such a flawed game recieved such universally high reviews.… Expand
  51. ExplodingWalrus
    Nov 12, 2019
    6
    This game established a genre, and for that it deserves a great amount of respect. What's more, it has held up reasonably well and is still fun to play today. That said, there are a few shortcomings that are worth noting. Often, these make the game a mixed bag.

    The world is a joy to explore, but the plot is meandering and unexciting. While the game features an all-star voice cast, the    This game established a genre, and for that it deserves a great amount of respect. What's more, it has held up reasonably well and is still fun to play today. That said, there are a few shortcomings that are worth noting. Often, these make the game a mixed bag.

    The world is a joy to explore, but the plot is meandering and unexciting. While the game features an all-star voice cast, the script doesn't afford them much of an opportunity to show off their skills. The in-game radio features an impressive amount of content, but the sound effects are oftentimes grating, with shouting pedestrians and engine groans often making for a cacophonous experience. The layout of the game's three islands is enormously memorable, but this may just be a side-effect of the lack of a map screen, meaning that players are forced to memorize the layout of Liberty City's various streets. The controls work quite well while driving, but the on-foot controls are a frustrating mess, particularly during combat.

    This game laid the foundation for what would come after, and for that it remains a giant. There is still a lot of fun to be had here, though it is located more in the random chaos that can come from toying with the game's dynamic systems than with the simplistic and uninspired missions.

    Give the game a shot. It's worth your time. Just tenure your expectations. Later games in the series would do much to refine the formula established here.    … Expand
  52. Sherbert
    Nov 10, 2020
    6
    Obviously, we need to take Metacritic's "must plays" with a grain of salt. I don't care about whether a game was influential, I care about whether it's enjoyable to play now. I played the game to 100%, I did everything. It was certainly fun overall, but I wouldn't recommend it to the average player. The game has aged, if you want to run around and wreck havoc, play GTA V. There is noObviously, we need to take Metacritic's "must plays" with a grain of salt. I don't care about whether a game was influential, I care about whether it's enjoyable to play now. I played the game to 100%, I did everything. It was certainly fun overall, but I wouldn't recommend it to the average player. The game has aged, if you want to run around and wreck havoc, play GTA V. There is no reason to come back to III, unless you want to sit in your car and listen to Chatterbox FM. In that case, it's understandable.… Expand
  53. Dareix
    May 17, 2021
    6
    gli metto un 6 solo perché è stato il primo gta in 3d e perché è uscito anni fa, ma giocarlo oggi è veramente noioso ed è privo di contenuti, idem la storia, interessante ma neanche piu di tanto
  54. Pereira2000
    Nov 12, 2022
    6
    He oido mucha gente diciendo que este juego es maravilloso por su censilleza pero a mi la historia me parecio muy mediocre. Hay que admitirlo es el gta que lo invento todo y se ve bien para tener mas de 20 años pero no me gusto y tiene la peor radio de toda la saga
  55. imalynxcat
    Apr 2, 2023
    6
    oynarken çok fazla hatayla karşılaştım ve san andreas oynadıktan sonra oynadığım için eğlenemedim.
  56. JakeH.
    Jun 3, 2004
    5
    ok man here it goes they need better fighting styles better mini shitty game things or whatever the RC shit stuff plus whats with two stars when you kill one cop totally gay man get em to fix it I might not bust the games in half like GTA 3 and vice city peace it...
  57. ApuN.
    Jan 30, 2004
    5
    Good game, 1st city is good but got boring after. plus whats up with old grannys pulling you out of the tank:S
  58. EdwardB.
    Sep 7, 2005
    5
    I have a love hate relationship with this game. Love: Great big cities with many areas to search. Love: Ability to shoot,crash, burn, bash and destroy. Love: realistic environment Love: Ability to steal cars and drive fast as hell and smash and run over people and things. Hate: Radio- horrible music repetitive turned it off second day playing. Hate: Repetitive sayings of pedistrians over I have a love hate relationship with this game. Love: Great big cities with many areas to search. Love: Ability to shoot,crash, burn, bash and destroy. Love: realistic environment Love: Ability to steal cars and drive fast as hell and smash and run over people and things. Hate: Radio- horrible music repetitive turned it off second day playing. Hate: Repetitive sayings of pedistrians over and over they say the same thing by the end of the game if you hear, "my mothers my sister" one more time .... your going to kill someone. Hate: Most missions are just too dam hard..period. I repeat get ready to be unbelivably frustrated and pissed. To add insult to injury when you dont succed on missions (there are many you will not succeed on -like all of them) you have to drive back to the mission trigger location so by the 10th time of doing a mission ( some missions take over 10 to 15 minutes) your swearing more then the game. Hate: Cops are too aggressive they progressively get worse up to 6 levels but by level 2 to 3 they dont stop coming. You cant outrun them as they pop out of no where...unlike Driver which you can. Hate: Targeting system on guns ....this is crap A enemy can be right on you and you cant get him. If mulitple enemie s gather around you forget it. This all adds up to a incredibly frustrating and annoying game...I played Hitman2, rockstars MANHUNT, and the Suffering right before this game and I do not know how this got a higher rating then these other games. I can't see someone playing this game for more then a month and not throwing up -this game gets very repetitive. I played it for two weeks, using cheats ( you will too or you'll be playing it for a year ) and getting 70% that was way enough for me...forever.… Expand
  59. PhoebeR.
    Jun 21, 2003
    5
    This game was ok. Ok so the gameplay and freedom is fantastic, but the graphics are SO PLAYSTATION ONE. Rockstar should maybe put a bit more effort into the graphics and make a better storyline with missions that arn't all the same!
  60. sinadoom
    Jul 30, 2012
    5
    This is of course one of the greatest games of all time both in its own merits and for its innovations for gaming as a whole. Unfortunately however, the PS2 controls make this game extremely awkward to play. nlike the PC version, you can't choose between classic and PC-style controls. Obviously this game would be much easier with a mouse and keyboard but despite the auto-aim even the startThis is of course one of the greatest games of all time both in its own merits and for its innovations for gaming as a whole. Unfortunately however, the PS2 controls make this game extremely awkward to play. nlike the PC version, you can't choose between classic and PC-style controls. Obviously this game would be much easier with a mouse and keyboard but despite the auto-aim even the start of the game can be difficult due to the awkward camera (both in car and on foot), clunky movement and looking around. To turn the camera you go into first person and can't do anything, and the sensitivity is too low. The game is an iconic masterpiece but the controls make it almost unplayable. It owuld be nice to at least be able to use the PC style controls with a controller.… Expand
  61. Tagirix
    Jul 5, 2016
    5
    Sorry, but I didn't like this game so much. Yeah, I am not an oldschool gamer who tried this title firstly 10 years ago. My first playtime was approximately 3 years ago and that time I didn't enjoy GTA III. After that, I finally completed the storyline and still didn't enjoy the game. I have to admit that this GTA was one of the worst I have played. Seriously, I was not into GTA III.Sorry, but I didn't like this game so much. Yeah, I am not an oldschool gamer who tried this title firstly 10 years ago. My first playtime was approximately 3 years ago and that time I didn't enjoy GTA III. After that, I finally completed the storyline and still didn't enjoy the game. I have to admit that this GTA was one of the worst I have played. Seriously, I was not into GTA III. Sorry, it's just my opinion. It is not interesting as GTA SA is.… Expand
  62. Xrayplayer
    May 7, 2021
    5
    In 2001 the game is mostly a masterpiece but I'm judging it now in this current date it didn't age that well but it's still okay although the movements are very Clancy and the camera and the shooting don't work smoothly the driving is also kinda bad the car lose control quickly and it explode quickly, the story is a joke but you play as silent character what do you expect, it can be funIn 2001 the game is mostly a masterpiece but I'm judging it now in this current date it didn't age that well but it's still okay although the movements are very Clancy and the camera and the shooting don't work smoothly the driving is also kinda bad the car lose control quickly and it explode quickly, the story is a joke but you play as silent character what do you expect, it can be fun for some reason it deserves a 5 it's a fine game.… Expand
  63. SuperSonicJunus
    Sep 9, 2023
    5
    Never beat this one but I’ve gotten damn close so I think I can give it MY proper rating. Vice City was my 1st played GTA but this one was soon after. This game was pivotal in revolutionizing sandbox games but it’s really not good even for its time. It’s clunky, the protagonist is silent for some reason, and the soundtrack doesn’t come close to VC or SA. I’ll beat it one day, don’t reallyNever beat this one but I’ve gotten damn close so I think I can give it MY proper rating. Vice City was my 1st played GTA but this one was soon after. This game was pivotal in revolutionizing sandbox games but it’s really not good even for its time. It’s clunky, the protagonist is silent for some reason, and the soundtrack doesn’t come close to VC or SA. I’ll beat it one day, don’t really want to. Haha… Expand
  64. JamesN.
    Apr 19, 2006
    4
    I never understood this game. The one thing I will give it credit for is the incredibly in-depth world it allows you to explore. But there is nothing more than that. I get a little tired of the "let's shoot everything" formula. And the story was never all that great. I love violence, but this just gets redundant. This game was not the revolutionary game everyone made it out to be. I never understood this game. The one thing I will give it credit for is the incredibly in-depth world it allows you to explore. But there is nothing more than that. I get a little tired of the "let's shoot everything" formula. And the story was never all that great. I love violence, but this just gets redundant. This game was not the revolutionary game everyone made it out to be. And game developers, please stop trying to copy this game, it's been done to hell.… Expand
  65. KashiK.
    Oct 22, 2006
    4
    This game sucks. Yeah, it's fun to "explore" the world but THE WORLD IS SMALL. It's interactive, detailed, and has alot of people to kill for no reason. Killing people gets fun for about 1-3 hours then you will TRY to get past the story. I was in shock on how lousy the story was. This game is recommended to people that are just stupid only. DO NOT GET THIS GAME!
  66. GaborA.
    Nov 11, 2003
    4
    The most overrated game of all time (besides Vice City). Elements of every game are adapted, but in the most pathetic and simplistic manner. Driving is boring, and racing impossible. Combat is like a pathetic platform game. If you want large environments play Tony Hawk where at least interesting play can be done in them.
  67. JonasW.
    Feb 4, 2002
    3
    The game is straight up stupid and dull.
  68. CoolAmIvan
    Sep 10, 2002
    3
    Hey ''geoff c.'' u think im stupid?? well there is a town called boggeville. its codename for the 4th city. I know the secret how to get there. and in the 4th city there is a blacksmith and u you can use swords. there is also a big fight with this dude that takes forever to load. maybe u should know what ur tokin aboot before u go tellin me that im stupid. now go play Hey ''geoff c.'' u think im stupid?? well there is a town called boggeville. its codename for the 4th city. I know the secret how to get there. and in the 4th city there is a blacksmith and u you can use swords. there is also a big fight with this dude that takes forever to load. maybe u should know what ur tokin aboot before u go tellin me that im stupid. now go play ur 3 cities loser because u will never know the secret to boggsville!!!! hahahah! !!!!! muhahaha!!!!… Expand
  69. coolamIvan
    Jul 5, 2003
    3
    like i sed before, i was really excited to be able to go to the fourth city but when i got there... it wook forever too load and even though you got to use sqords... it had very bad collision detection. first 3 cties are ok but 4th city sucks. after all i went through to get there and it was a let down... and thats the bottom line cause' i told it to you!
  70. E.G.
    Mar 17, 2003
    3
    The worst graphics I've ever seen. NICE FLIPPER HANDS!!!!!! What a joke. What happened to realism??? Rockstar needs to learn from ubi soft (splinter cell ring a bell??)
  71. DashelJ.
    Jul 27, 2007
    3
    Grand Theft Auto III and its successors comprise the worst examples of controversy mistaken for ingenuity that the gaming industry has ever seen. If you block out the hype and the imbecilic reviews in an honest attempt to judge this game for what it is worth, you would surely arrive at a score no more than 2 or 3 points higher than the one I have submitted. Beyond the initial draw of Grand Theft Auto III and its successors comprise the worst examples of controversy mistaken for ingenuity that the gaming industry has ever seen. If you block out the hype and the imbecilic reviews in an honest attempt to judge this game for what it is worth, you would surely arrive at a score no more than 2 or 3 points higher than the one I have submitted. Beyond the initial draw of 'something unexpected' and the occasional recurrence of a shamefully base desire to clumsily, chaotically, and downright ridiculously murder heaps of random clones wandering the drab streets of Liberty City, I can think of nothing worthy of praise in this over-inflated piece of trash.… Expand
  72. CoolamIvan
    Jul 12, 2002
    3
    It sucks how you have to wtach all the cutscenes each time you enter a new town (especially the long cutscene when you enter boggsville), and it is very linear. And i hate the blacksmith at the items store, he always buys things from you for 1/4 of what they are actually worth. plus it is very short, kinda like diablo but not as good at all. it gets sooo boring when it has to load each It sucks how you have to wtach all the cutscenes each time you enter a new town (especially the long cutscene when you enter boggsville), and it is very linear. And i hate the blacksmith at the items store, he always buys things from you for 1/4 of what they are actually worth. plus it is very short, kinda like diablo but not as good at all. it gets sooo boring when it has to load each battle for about 1 min. before actually fighting. stay away from this trash pile, stay far, far away.… Expand
  73. Broyax
    May 8, 2020
    2
    L'un des premiers jeux en monde ouvert mais malheureusement aussi... l'un des pires ! on passera sur le fait que le jeu soit bien moche -y compris pour son époque- mais pas les graves problèmes de maniabilité ! en effet, GTA3 se manie comme une merde à pied, comme si chez Rocktarte, on avait pas (encore) compris comment faire un TPS correctement... c'est pourtant pas la mer à boire maisL'un des premiers jeux en monde ouvert mais malheureusement aussi... l'un des pires ! on passera sur le fait que le jeu soit bien moche -y compris pour son époque- mais pas les graves problèmes de maniabilité ! en effet, GTA3 se manie comme une merde à pied, comme si chez Rocktarte, on avait pas (encore) compris comment faire un TPS correctement... c'est pourtant pas la mer à boire mais ils n'y arrivent pas... et d'ailleurs ils n'y sont jamais arrrivés par la suite... ou les suites !

    Ainsi, par exemple, lorsqu'on veut regarder avec le stick droit, le jeu passe en vue subjective ! c'est putain de n'importe quoi... et pendant qu'on vise, de gros crochets entourent les cibles qu'il faut faire défiler manuellement ! aucun réticule à l'écran, aucune visée libre... évidemment. De toute évidence, GTA3 est un TPS foiré, foireux et injouable ! D'ailleurs, alors que la conduite reste tout-à-fait correcte, le problème de la vue se repose en voiture : trop zoomée et brutale avec le stick droit !

    Ce n'est pas le pire (même si ça y contribue) car par ailleurs le ton général du jeu très caricatural est souvent pénible, toutes les voix sont en amerloque (caricatural) avec plein de gros mots pour faire genre (ou style ?) et côté "soins", c'est juste... "va te faire foutre". De toute façon, en cas d"échec, le jeu ne pardonne rien et n'a prévu aucun checkpoint : il a juste prévu "va te faire foutre" en te téléportant à l'hosto ou chez les flics, en te piquant une partie de ton fric et en te piquant... toutes tes armes !

    Il faudra donc recommencer la mission du début bien sûr, ce qui veut dire bien pire que cela en fait : repartir de l'hosto, aller racheter un flingue, aller voir le con qui te donne la mission,puis aller sur le lieu de la mission... ; sinon recharger carrément la sauvegarde d'avant, ce qui implique d'avoir encore ses armes mais de se retaper le trajet jusqu'au con, puis d'aller sur le lieu de la mission etc...

    De toute façon, GTA3 ne sauvegarde jamais tout seul et il faut régulièrement retourner à la planque pour simplement... sauvegarder. On croit rêver... Pour le reste, trop de missions en temps limité et de scripts destinés à te les briser menues afin de te faire recommencer une quantité de missions de merde hallucinante...

    Je mets 2 quand même pour la ville, les radios et la conduite des bagnoles, arcade mais bien faite ! c'est tout ce qu'ils ont jamais réussi à bien faire : la conduite dans leurs villes de merde...    … Expand
  74. bewarbarzani26
    May 26, 2022
    2
    This review contains spoilers, click expand to view. Nslksnsksnsmssseemsmsndnndkdndndndjkdkdkdldjeebsbgtagtagtagattqqqgatagagatagtagatatagatgaagatagagataftaa… Expand
  75. JoneB.
    Apr 23, 2003
    1
    This game get's an 1 fore it's violence, the rest sucks.
  76. BrianD.
    Jan 4, 2006
    1
    Horrible game. The controls are clunky and the story might as well have been made by a 5 year old. It gets 1 point because killing random people is fun for about 4-5 hours, but even mass homicide gets old quick in this game.
  77. Adder
    Jun 15, 2002
    1
    It's a very bad game. When I started it, it worked very SLOW. It shocked. And it even went stock. So if there is someone who had the same problem, please HELP me with this so I can rate this very good game much higher!
  78. the4castlekings
    Jan 15, 2023
    1
    This game is awful. GTA3 is one of the most boring, unplayable games out there and it does not deserve the score it has. If the game was really a 10, it top GTA4 and GTA5 but it fails to put a dent in either of those games. Would not recommend
  79. KanameS.
    Dec 20, 2006
    0
    This game royally sucked. This had to have been the worst game I've ever played. Aside from the fact that the game is totally overrated, there was no real plot to it and I believe that this game should be burned and never seen again. I stand with my rating.
  80. Someguy
    Mar 22, 2003
    0
    The most horrible game ever!!! When i used the tank i already got busted and when some guy fights me i have to fight back rite?once punched him i got a wanted level like wtf is this sh*t it should be in the toliet. The graphics suk. Stay away from this game when u see it!!
  81. AlecMichaud
    Apr 8, 2004
    0
    i hated this game cause itlicked nuts and u getall this money and wat do u do wit it besides by shitty guns and in the whole game the little faggot never even talked and he sat around and jack off all day and never even killed anyone little bitch
  82. JamieM.
    May 7, 2004
    0
    This game would be excellent if i knew how to go.
  83. KyleB.
    Nov 6, 2002
    0
    The game made to deter people from the playstation 2. This game could quite possibly be the worst game I have ever played, I have played some very bad games. The very plot of the game is both pethetic and illy prepared. The story of revenge has gotten to be one of the lamest and most predictable with a very lame plot twists. The sole fact the game is based on lust and ilegal activites. The game made to deter people from the playstation 2. This game could quite possibly be the worst game I have ever played, I have played some very bad games. The very plot of the game is both pethetic and illy prepared. The story of revenge has gotten to be one of the lamest and most predictable with a very lame plot twists. The sole fact the game is based on lust and ilegal activites. the game has got to be one of the worst looking games ever on the ps2 save for rune. The games only saving grace is the freedom of action which will be brought to a sudden end because of the swift justice brought about from Liberty Citys finest! The weapons are both unintresting and leave alot more to the immangination. This game should not be bought, possibly only to be rented, but only on a cheap night!… Expand
  84. DennyD.
    Dec 25, 2001
    0
    The action is great; graphics are great; machine response to player action is superb, but the sexual content and foul language were not necessary to make it a great game. I rate it in the toilet where it belongs.
  85. pierreb.
    Jun 11, 2005
    0
    This game was not worth my money.
  86. Mr.x
    Aug 29, 2006
    0
    Bad art no original music and bad sound bad acting encurages savage behavior hmmm can I sue that they wasted my time? lol
  87. SammyHauguth
    Aug 29, 2023
    0
    Worst game ever made, and It's by the idiots at Rockstar Games. I don't understand how any one could even give this garbage score at all. It's so bad a d such a garbage.
  88. noctis242
    Jan 12, 2016
    0
    Almost same score than gta san andreas? ... This is pathetic cause is 100% more limited than the last gta of ps2.

    You can't ride bisycles here, buy clothes, if you want to fly you cant take an airplane and fly the world you have to use glitchs in the game, you can't buy nothing apart of weapons, You cant increase your stats to run more time, not even go to a gym or eat, cant swim and    Almost same score than gta san andreas? ... This is pathetic cause is 100% more limited than the last gta of ps2.

    You can't ride bisycles here, buy clothes, if you want to fly you cant take an airplane and fly the world you have to use glitchs in the game, you can't buy nothing apart of weapons, You cant increase your stats to run more time, not even go to a gym or eat, cant swim and much more things..

    For the moment this game went on sale was very good but as best ps2 game of gta lacks too much.    … Expand
  89. mikehettfield
    Apr 12, 2016
    0
    For this game's fault i haven't touched videogames in 20 years, the characters are ugly, the driving sucks, the shooting sucks, the roaming sucks, this game is about nothing, thanks to this game, the industry it's in the sorry state it's in now.
  90. Sky_nemO
    Oct 10, 2018
    0
    Лучшая игра!!! С юмором и хорошей атмосферой!
  91. Kacak321
    Apr 13, 2020
    0
    Bad game.......................................................................
  92. FINPOSTI
    May 19, 2023
    0
    no its not just good like its not just good as i thought that this game was supposed to be, i dont like the game as much as someone else does so i give this game this exact rating as it it showing here, i am not a pirate btw
next
Page:

Awards & Rankings

2
#2 Best PS2 Game of 2001
4
#4 Most Discussed PS2 Game of 2001
1
#1 Most Shared PS2 Game of 2001

Critic Reviews

All reviews »
Metascore
97

Universal acclaim - based on 56 Critic Reviews

Critic score distribution:
  1. Positive: 56 out of 56
  2. Mixed: 0 out of 56
  3. Negative: 0 out of 56
  1. Voodoo Extreme
    98
    The end-all, be-all of console action games. Period...For me GTA3 is the best action game I have ever played on a console system and I highly recommend it to adults (the intended audience of this game) who know the difference between good and evil.
    Read full review
  2. Into Liquid Sky
    100
    An insanely deep game that offers a lot to do outside of the 70+ missions. If you understand that it's just a game and that these selfsame actions are not healthy in the real world, you'll enjoy a well-developed world disguised as a deviously fun game.
    Read full review
  3. Next Generation Magazine
    80
    Adding to the frustration is the fact that your targeting system is practically useless, and the vehicle physics model is annoyingly floaty. [Jan 2002, p.78]
See all critic reviews »