User Score
8.4

Generally favorable reviews- based on 1185 Ratings

User score distribution:
Buy Now
Buy on

Review this game

  1. Your Score
    0 out of 10
    Rate this:
    • 10
    • 9
    • 8
    • 7
    • 6
    • 5
    • 4
    • 3
    • 2
    • 1
    • 0
    • 0
  1. Submit
  2. Check Spelling
  1. PsychoMantis
    Mar 11, 2002
    10
    A greeeaaat game, lotsa replay value in this title, very nice "radio stations" you can select while in a vehicle, one minor gripe though, the graphics could be better, but considering the scale and fun of this title it's very easily forgiven A+!!!!
  2. PhilW.
    Mar 1, 2002
    10
    I think it's just endless fun which doesn't lack anything.
  3. BrookU.
    Mar 4, 2002
    10
    I'm speechless. This game is amazing.
  4. DaveE.
    Apr 11, 2002
    9
    This is a totally amazing game. The missions vary widely and never get boring, and almost all of them have multiple solutions. This game loses points for a slightly 'floaty' physics engine, and a nearly unusable targeting system. Despite these drawbacks, this title is a must-buy for any PS2 owner.
  5. JonD.
    Apr 16, 2002
    10
    This game is the best in the world. I like running over the person's car you just stole.
  6. IanWendt
    Apr 3, 2002
    10
    this is the best game for playstation 2. Why? Cuz you get to pick up sluts and fuck their brains out. Yes yes i know im a nymphomaniac, but what straight guy isnt? The best part is using the cheat that lets you be a slut and then pick up a slut so they can have lesbo sex!!! Awesome isnt it?
  7. Jimbob
    Jun 10, 2002
    10
    The best game ever, although when I took to a pimp on the side of the road with my baseball bat, he didn't drop money like in the game.
  8. CrisC.
    Jun 21, 2002
    10
    Suppa. Naturally Suppa!
  9. EstebanB.
    Jun 2, 2002
    10
    One of the best games created, since who knows what.
  10. Steve
    Jun 2, 2002
    10
    Do yourself a favor -- if you don't own this game, go buy it. Trust me, you will NOT regret it. Has to be one of the best all time games
  11. SimonO.
    Jun 22, 2002
    10
    This is the best game in the world to ps2, I played it in a store for free and now I have the game at home. It is just addictive!!
  12. JasonL.
    Jul 11, 2002
    10
    Hey gamemakers, if you produce games like this you will make a lot of money, it is that simple. PLEASE don't change the sequel too much.
  13. UmbertoM.
    Jul 25, 2002
    10
    There is only one thing to say about this game... awesome. The sense of freedom that it gives you cannot be described. GTA III and Medal of Honor Frontline must be owned by anyone. Frankly it's quite impossible to reach their greatness.
  14. J.Lowell
    Jul 8, 2002
    10
    THIS GAME ROCKS! I can't wait for the next one!!!!!! buy this game.
  15. ConsuelaS.
    Mar 11, 2003
    10
    Grand Theft Auto 3 is the best game ever envented. I am really hooked on the game when I play it. My cousin always yells at me for staying on it too long and but I end up having to get of off the game because my cousin ends up beating me up. Thankyou for taking the time to read my comments,
  16. DarylR.
    Mar 7, 2003
    9
    This game was the greatest game ever with GTA Vice City!!!!!!!
  17. DonnyF.
    Aug 8, 2003
    10
    This game is awesome for those who say it sucks YOU SUCK!!!!!!
  18. AndrewJ.
    Jan 31, 2004
    9
    A lot of fun.
  19. PIRANHAg.
    Jan 7, 2004
    10
    Rockstar guys I LUV YOU. Simply Perfect.
  20. JasonB.
    Nov 16, 2005
    8
    The criminal underworld backdrop is always fun to have as a storyline, but the gameplay of GTA 3 is fun with or without it.
  21. MarkG.
    Jan 21, 2005
    10
    A classic title that should be in every gamer's collection. Its success is evident in the endless clones and comparisons that continue even today. Replayability well beyond hundreds of hours.
  22. MikelR.
    Jun 4, 2005
    10
    How could you not like it?
  23. PhilipP.
    Jan 24, 2007
    10
    The reason I give a ten is not because its the best game out because it isn't but because I really thing this game changed the revolution of the gaming world it was amazing and still is 10/10.
  24. JohnS.
    Feb 24, 2007
    8
    This game is pretty good, but not perfect. Good use of open-endedness though. Cool Am Ivan, there is no Boggsville. Theres a ghost area that was used for the opening act of GTA 3, but it isnt solid and can be gotten there by dodo going north of shorside vale. There is no blacksmith and no swords and no boss battle there. Don't believe this liar. And the game doesn't suck, either.
  25. Kewlkat
    Aug 22, 2007
    9
    "Beyond the initial draw of 'something unexpected' and the occasional recurrence of a shamefully base desire to clumsily, chaotically, and downright ridiculously murder heaps of random clones wandering the drab streets of Liberty City, I can think of nothing worthy of praise in this over-inflated piece of trash." If you understood a single word I quoted above, than this game is"Beyond the initial draw of 'something unexpected' and the occasional recurrence of a shamefully base desire to clumsily, chaotically, and downright ridiculously murder heaps of random clones wandering the drab streets of Liberty City, I can think of nothing worthy of praise in this over-inflated piece of trash." If you understood a single word I quoted above, than this game is too much fun for you. Sorry. :( Expand
  26. SteveS
    Feb 26, 2008
    10
    The fact is, GTA III is the video game equivalent of Nirvana's Nevermind. This is the one that broke the mold and changed the entire industry. Love it or hate it, you have to appreciate the fact that GTA III is just as important as Super Mario Bros., The Legend of Zelda, Pac-Man or Space Invaders.
  27. MatthewC.
    Apr 26, 2008
    10
    I'm only 10 but i like all GTA games and this is the first GTA game i ever played and it's awesome!!!! I'm getting a PSP and GTA Liberty City Stories and Vice City Stories for my birth day which is in less than 2 weeks. This is a Must have game!!!
  28. Lod
    Nov 4, 2001
    10
    From the moment I started playing this game, I couldn't stop! It's an amazing experience, and I would suggest it to everyone with a PS2. In my opinion, GTA3 already has a place with the greatest games of all time.
  29. AliceL.
    Dec 17, 2001
    10
    I don't care what other people say, there is absolutely nothing in this game I could possibly think that can be improved. The game life alone made me give this a ten, not including graphics, story line, cars, weapons, etc. etc. This game is awesome!
  30. ShavarM.
    Dec 21, 2001
    10
    This is the bomb of 2001/2002.
  31. ChrisC.
    Dec 23, 2001
    10
    Off the chain!!! Music from "Scarface," Mafia terms all the good sh*t! The ultimate gangsta game!
  32. ajhounshell
    Dec 27, 2001
    10
    this game is fucking sweet pete m said the driving graphics sucked well fuck u the graphics are off the hook how good do u want a fucking game its not allways gonna be perfect. well this site is sweet too.p.s gggggggtttttttttaaaaaaaaa 33333 rocksssssssss bye.ps2 fuck ps2 two next year because next year theres going to be ps 3 and its upgraded like 10 times better. so se ya
    ps 1 more time
    this game is fucking sweet pete m said the driving graphics sucked well fuck u the graphics are off the hook how good do u want a fucking game its not allways gonna be perfect. well this site is sweet too.p.s gggggggtttttttttaaaaaaaaa 33333 rocksssssssss bye.ps2 fuck ps2 two next year because next year theres going to be ps 3 and its upgraded like 10 times better. so se ya
    ps 1 more time im a male im si ngle 13 any girls that are hot email me and put as subject hi boy my email is aj6996@hotmail.com bye.
    Expand
  33. RoyL.
    Dec 27, 2001
    10
    GTA 3 is a masterpiece. Just f... awesome.
  34. RiccardoF.
    Dec 27, 2001
    10
    What can I say? Bellissimo!!! Fantastico!!! The Best! Please give us a sequel soon! Pete and Denny, come on! Just say the truth! CAPISCI A ME!
  35. RobJ.
    Dec 3, 2001
    10
    This game is the best - if u like Crazy Taxi, any shooting game or any driving game this game has it all. If u haven?t played it, u haven't lived.
  36. TerryJ.
    Oct 26, 2001
    10
    This game has great screen play, perfect animation...a must have!
  37. PatrickM.
    Oct 26, 2001
    10
    I didn't care for GTA 1 or 2, so my expectations were a bit low going into GTA 3 -- was I ever in for a pleasant surprise! GTA 3 is HUGELY entertaining. The graphics slow down every now and then, and there is a lot of hardcore mature content (violence and sexual innuendo), but the gameplay is so incredibly good you soon forget you're playing a game at all -- totally immersive I didn't care for GTA 1 or 2, so my expectations were a bit low going into GTA 3 -- was I ever in for a pleasant surprise! GTA 3 is HUGELY entertaining. The graphics slow down every now and then, and there is a lot of hardcore mature content (violence and sexual innuendo), but the gameplay is so incredibly good you soon forget you're playing a game at all -- totally immersive and a must-own for any PS2 owner! Expand
  38. SeanC.
    Oct 27, 2001
    9
    A great game which is truly greater than the sum of its parts. Frustrating at points, though.
  39. DarienA.
    Oct 29, 2001
    9
    At the top of it's game.
  40. ShaunH.
    Nov 26, 2002
    10
    This game is definitely the best i've ever played. I'd really appreciate more info. on the 4th city if its boggeville or boggsville i have heard many rumors about it and would like to know if it really exists. I've also heard of another person to work for and that he gives u 7 more missions i've heard his name is Darkal anyone know about him?
  41. Wowww
    Jan 13, 2002
    10
    Two words: BAD. ASS.
  42. [Anonymous]
    Jan 23, 2002
    10
    Pissed? Pump some bitch fulla lead! And you don't have to go to jail either. GTA3 is the answer. Stop beating that pillow! GTA3 is the ultimate stress reliever. If this game existed since the beginning of time there would be no crime! Extremely satisfying. The one game that everyone should own and you can NEVER get bored of. I give this game 11!
  43. AaronB.
    Jan 28, 2002
    10
    I haven't even played the game yet, but still it is a masterpiece.
  44. AliciaR.
    Jan 28, 2002
    10
    I cannot stop playing!
  45. Chris(TheJACK)
    Jan 29, 2002
    10
    This game rules and the guy who rated it in next gen should be fired and learn what games are all about. This has cutting edge graphics and a full graphically interfaceable city! What other game has that?! ANSWER ME Mr. I'm from next gen. gaming magazine and I don't know what games are all about because I've never PLAYED THEM! No other game has that. That's the answer. This game rules and the guy who rated it in next gen should be fired and learn what games are all about. This has cutting edge graphics and a full graphically interfaceable city! What other game has that?! ANSWER ME Mr. I'm from next gen. gaming magazine and I don't know what games are all about because I've never PLAYED THEM! No other game has that. That's the answer. What are you playing virtual reality games that link to your nerve cords?! That's the only step forward from here! Absolute must buy it's the reason I bought PS2!! Expand
  46. JonH.
    Feb 21, 2002
    9
    The best stress reliever I've seen lately.
  47. H.H.Lee
    Mar 22, 2002
    10
    Sure, this game ain't as pretty as other 'next-gen' titles, but anyone who has the brains to take gameplay into consideration, will definitely deem this game as one of the finest games ever made.
  48. MikeyC.
    Jun 18, 2002
    10
    So sweet!!!
  49. J.Bob
    Jun 25, 2002
    10
    One word, AWESOME.
  50. JoshuaK.
    Jul 16, 2002
    10
    Best game ever!
  51. BrandonH.
    Aug 11, 2002
    10
    I have no freakin clue what cool am ivan is talking about. Since when is there a town in gta3 called boggsville, and since when does gta3 have battles in it? I'm pretty sure hes talking about godai: elemental force. Well, this game is great! It is a bit hard at times, but manageable. One thing i would like better in gta vice city is in car views, helicopters that stay in air longer I have no freakin clue what cool am ivan is talking about. Since when is there a town in gta3 called boggsville, and since when does gta3 have battles in it? I'm pretty sure hes talking about godai: elemental force. Well, this game is great! It is a bit hard at times, but manageable. One thing i would like better in gta vice city is in car views, helicopters that stay in air longer than 5 seconds, and better graphics. It would also be cool to go in bulidings. A better ending would be awesome too! Expand
  52. KevinW.
    Jun 23, 2003
    10
    I love this movie. Its awesome.
  53. KevinS.
    Mar 13, 2004
    9
    I love this game because it is fun and it's always somethin' to do.
  54. SeanB.
    Jul 15, 2004
    10
    Dark, intriguing, addicting. Nice to play when youre having a bad day. Story is probably the best on any platform for any game ever in eternity- even though I thought it ended kind of abruptly.
  55. Shills
    Dec 26, 2001
    10
    Everything you could have ever dreamed in a game - realism is unbelievable. A shame the attitude of people like Denny D. hinder games such as these being released.
  56. CoreyR.
    Dec 28, 2001
    10
    This is one of the few games that is fun to watch other people play.
  57. WesG.
    Dec 29, 2001
    10
    The Best game I have played yet! I have yet to play a game that conducts as much fun as this title. BUY THIS GAME! That's all there is to it. I would like to pat Rockstar and the other designers of this title on the back. KEEP UP THE GOOD WORK BOYS/GIRLS!!!
  58. MatthieuR.
    Dec 16, 2004
    10
    The greatest videogame ever made.
  59. TimG
    Dec 23, 2007
    10
    Who cares about the controversy?!?!?! Get to grips DASHEL J its a game and probably the bet I've ever played on so stop whining!!!
  60. Oct 3, 2010
    9
    The game that transformed the genre and the industry~ I remember staying at a friends place, me and a few others taking turns to play this game I could never forget how much fun this game has brought me over time and how long it stayed relevant and fun.
  61. Sep 20, 2013
    10
    GTA III is the 3rd installment in the GTA series. The game remains one of the most contrevisial games ever, the game is violent and cool, the story is the best thing about the game and the gameplay now isn't that unique and the graphics is what everybody is about but this game came out in 2001 and those were the best graphics for those years. GTA III is an amazing game and it's incrediblyGTA III is the 3rd installment in the GTA series. The game remains one of the most contrevisial games ever, the game is violent and cool, the story is the best thing about the game and the gameplay now isn't that unique and the graphics is what everybody is about but this game came out in 2001 and those were the best graphics for those years. GTA III is an amazing game and it's incredibly alot and I mean alot of fun. 10/10 Expand
  62. Apr 16, 2013
    10
    Grand Theft Auto III is, quite simply, one of the greatest video game accomplishments in history. It single-handedly invented the sandbox genre, and it's my favorite video game of all time. It gets nearly everything it tries to do right, and in doing so, made history. The open ended gameplay is always fun, but that's what most people focus on, but who could blame them? Before GTA III,Grand Theft Auto III is, quite simply, one of the greatest video game accomplishments in history. It single-handedly invented the sandbox genre, and it's my favorite video game of all time. It gets nearly everything it tries to do right, and in doing so, made history. The open ended gameplay is always fun, but that's what most people focus on, but who could blame them? Before GTA III, gamers had never played anything like this before. However, there is a story here revolving around structured missions that shouldn't be missed. GTA III combines action/adventure and driving games flawlessly. With its respectable amount of vehicle and weapon choices, alongside the size of the map and the progressively tougher story missions, this is an extremely varied game that will almost sate anyone's appetite for a lengthy adventure to sink their teeth into. The story itself is, admittedly, nothing special, but with the sheer size of this game (for its time), to even incorporate a flowing narrative is, without a doubt, something to marvel. That's basically how I saw this game when it was released; something I was absolutely in awe at. The controls are spot on for driving, walking around, punching random pedestrians, etc., but the targeting system for aiming weapons will leave a bad taste with some gamers. Does that make it bad? No. Once you learn how to use it (along with conserving health and armor) you can get through any mission with minimal trouble. Any reviewer who could possibly label this masterpiece as a bad game simply has no business reviewing video games. That Sleeping Dogs, Crackdown, Infamous games you've been playing? All of those owe GTA III, big time. This game is the blueprint for sandbox games, and a damn fine model to go from, at that. Even games like the Tony Hawk franchise took note of the open world design in later entries, and it's hard to say that GTA III didn't have a hand in inspiring any of the games I've mentioned above. It's simply a monumental title that must be played by anyone who's mature enough to handle its visceral, gritty violence. I'll be the first to admit that it's not perfect, but it's so, so close to it, and is easily my favorite game in the GTA series. I'd even dare say that if you give this game a bad review, you had no business playing video games in general. GTA III has so much great going for it, you'll easily overlook the bad if you simply just take the time to get used to it. Which sadly, a minority of people won't. Their loss. 10/10. Expand
  63. Jan 1, 2014
    8
    Grand Theft Auto 3 was a huge leap forward for videogame history as it featured one of the first fully 3D open world environments and a good story mode.
  64. Mar 16, 2013
    10
    Cool am Ivan is 0% right. GTA III is the best PlayStation 2 game ever so dont listen to um..."Cool" am Ivan. The story-line is breathtaking and has a awesome set of missions, including Toni Cipriani!
  65. Dec 27, 2013
    10
    I sold my n 64 and 30 some odd games plus a ps1 and some more games to buy a PS2 and GTA 3. It was worth it. I Love how revolutionary this game was. I brought open real worlds gaming to the millennium. Boy gaming wise this started will an earthquake that shocked the gaming industry. One of the most innovative titles i have ever had the grace to play. Plus the main character does not haveI sold my n 64 and 30 some odd games plus a ps1 and some more games to buy a PS2 and GTA 3. It was worth it. I Love how revolutionary this game was. I brought open real worlds gaming to the millennium. Boy gaming wise this started will an earthquake that shocked the gaming industry. One of the most innovative titles i have ever had the grace to play. Plus the main character does not have an annoying voice nor does he say cheesy cliches. Expand
  66. Sep 28, 2013
    10
    The second game after MGS 2 that started the 3D era. Playing this game really see how crime really dangerous is, so kids learn not to copy these actions or you might end up in jail. The game is exciting,
    good to kill civilians and things to do are superb. Classic.
  67. Sep 29, 2013
    10
    Si bien para mí "Grand Theft Auto" empezó en Vice City, "Grand Theft Auto III" es legendario y digno de cualquier espectador que siga disfrutando de una de mis consolas favoritas: la legendaria PlayStation 2, y ¿Por qué es mi favorita? Porque juegos como "Gand Theft Auto III" se presentaron para esta increíble consola. Impresionante lo que se es capaz de hacer en este mapa y me acuerdoSi bien para mí "Grand Theft Auto" empezó en Vice City, "Grand Theft Auto III" es legendario y digno de cualquier espectador que siga disfrutando de una de mis consolas favoritas: la legendaria PlayStation 2, y ¿Por qué es mi favorita? Porque juegos como "Gand Theft Auto III" se presentaron para esta increíble consola. Impresionante lo que se es capaz de hacer en este mapa y me acuerdo hace mucho tiempo la primera vez que lo jugué casi estaba por llorar porque directamente era hermoso lo que pasaba por mis ojos. "Grand Theft Auto" manda. Expand
  68. Oct 30, 2013
    8
    the two firsts gta games were nothing special,but in the third game and with another generation they made something really special and terrific,this game would change this series forever.
  69. Apr 21, 2014
    10
    The Best in the Grand Theft Auto Series gorgeous graphics good story line awesome controls great characters i think this is the Citizen Kane of gaming in my opinion i recommend playing this awesome game
  70. Nov 18, 2014
    8
    THIS GAME IS SO AWESOME ! The only thing I complain about is the controls other than that this game is awesome ! It has cool graphics great gameplay and variety for weapons ! GET THIS GAME ON THE PSN
  71. Jul 16, 2014
    10
    I love all the characters in this game, I love Claude, I love almost everything in this game. GTA V and GTA IV don't have that feeling I have with older GTA games. If you see this game on sale, GET IT!!! Steam can have my $3.74 for this game :)
  72. Aug 15, 2014
    8
    This review contains spoilers, click expand to view. Grand Theft Auto III is one of a kind. With a 3D and 2D Third Person View, epic artwork for the Heads Up Display and 3D models like no other in the time, Grand Theft Auto III has nailed the best Graphic Design I have ever seen that comes from the year it was made. Sure, there are other good designs like the Elder Scrolls at the time but the artwork on the box and in game makes me go "Holy f*ckin' ****

    The gameplay has again, a 3D and 2D Third Person View, making this as view-customizable as Fallout. The free roam is quick but locked places can take time to UNlock the locations. Although there aren't many character customization options (-1), there is quite an array of weapons available to the player. Unlike San Andreas, it was a shame that the game had a garage without any modification options, making the vehicles barely customizable (-1).

    However, I like the way when you kick someone, you actually get money unlike the nowadays Grand Theft Auto where it automatically drops out of the victim's wallet after being killed. Not to mention geting stacks of money only worth up to $50.

    Grand Theft Auto III will always be one game withing my heart, even in this year of 2014.
    Expand
  73. Oct 19, 2014
    9
    Players are put at the heart of their very own gangster movie, and let loose in a fully-realised 3 dimensional city with a cast of hundreds, 50 plus vehicles, ranging from sports cars to ice cream trucks and from boats to buses, 3 hours of music, including opera, reggae, house, drum and bass, pop and disco, and a huge array of street ready weapons.
  74. Jul 11, 2020
    10
    Grand Theft Auto III is the only 3D open world game that started it all and it’s a revolutionizing gamechanging masterpiece.
  75. Mar 22, 2015
    8
    The days before Grand Theft Auto became a world of sexual themes was certainly a good one even if I am now shaking my head at the amount of strong language featured here. The graphics here are a bit under par if I do say so myself but the gameplay itself is top notch. Grand Theft Auto III is quite simply put a fun romp through a huge city. It's incredibly innovate yet outlandish at theThe days before Grand Theft Auto became a world of sexual themes was certainly a good one even if I am now shaking my head at the amount of strong language featured here. The graphics here are a bit under par if I do say so myself but the gameplay itself is top notch. Grand Theft Auto III is quite simply put a fun romp through a huge city. It's incredibly innovate yet outlandish at the same time and that is what defines GTA. Expand
  76. Aug 8, 2015
    10
    Very good! Game with great storyline, gameplay , story , graphics for that time , cars, weapons and all! Very much recommend this game ! I played as a child, always had difficulty in some missions until passed, but after battling ! That's because I was very bad at playing , was the first 3D game I played in my life , the graphics were simply sensational when I played for the first time !
  77. Aug 12, 2015
    10
    The second best GTA of them all!
    Let me put one thing out there, this was not my first GTA game. My first was GTA 2 then 1 and then 3. Mentioning that is just to show that it is not nostalgia alone speaking when I say that the only GTA to beat this in my eyes was GTA V. Many people prefer San Andreas (and with good reason) however I felt that game was too clustered for its own good which
    The second best GTA of them all!
    Let me put one thing out there, this was not my first GTA game. My first was GTA 2 then 1 and then 3. Mentioning that is just to show that it is not nostalgia alone speaking when I say that the only GTA to beat this in my eyes was GTA V. Many people prefer San Andreas (and with good reason) however I felt that game was too clustered for its own good which made performance suffer greatly back in the day on consoles. This game has a great story in a dark realistic Liberty City with missions taking you to work with the mob, help out club owners or just create general mayhem! The graphics may not have aged well but they aren't painful to look at by any means and the game is still a joy to play. Especially with cheats.
    Expand
  78. Dec 24, 2015
    10
    Amazing game. Truly a revolutionary masterpiece. Anyone that doesn't like this game is on crack. So much variety, such a classic that helped shape games of this genre. Wether it's street racing or killing people, there is some thing for every one.
  79. Mar 6, 2017
    10
    GTA's first 3D venture turned out to be one the best games ever. This game blew my mind on christmas day 2001. Endless hours spent playing this game make it a must play game.
  80. May 13, 2016
    10
    Самая значимая игра в серии и одна из самых значимых вообще в игровой индустрии. Одна из первых игр, которая продвинула PS2. Первая 3D-игра в серии. Незамысловатый простой сюжет, где грабителя по имени Клод, предала Каталина. Естественно главный герой хочет отомстить. Этого он и пытается добиться в течении всей игры. Ему придется стать водителем, наёмником, убийцей. Он всё сделает радиСамая значимая игра в серии и одна из самых значимых вообще в игровой индустрии. Одна из первых игр, которая продвинула PS2. Первая 3D-игра в серии. Незамысловатый простой сюжет, где грабителя по имени Клод, предала Каталина. Естественно главный герой хочет отомстить. Этого он и пытается добиться в течении всей игры. Ему придется стать водителем, наёмником, убийцей. Он всё сделает ради денег. Геймплей тоже порадовал. Теперь это открытый мир без коридора, где можешь делать всё что захочешь. Графика на PS2-версии устарела, но всё равно ту мрачную атмосферу не передать словами. Абсолютно 10/10. Expand
  81. Nov 10, 2016
    10
    Really like the story line. I mean you play a mute who needs to get through life in Liberty City. Sometimes it is just plain fun to just screw around. 10/10
  82. Nov 13, 2016
    9
    GTA III... a great single player experience. The game play is good. There are plenty of missions in this game and all are very well made and fast paced. But there are are numerous glitches in the game. The story is well balanced. About the graphics... They are good for 2001. But sometimes the game lacks depth.
    Overall a great open world game with significant amount of features and also
    GTA III... a great single player experience. The game play is good. There are plenty of missions in this game and all are very well made and fast paced. But there are are numerous glitches in the game. The story is well balanced. About the graphics... They are good for 2001. But sometimes the game lacks depth.
    Overall a great open world game with significant amount of features and also have some down points too.
    Expand
  83. Jan 26, 2017
    10
    Out of this world!One of the game that you must play before you die!A game that shock us again since Doom!It Almost the best PS2 game.But after you beat the game(complete 100%)you will feel bored.
  84. Sep 17, 2018
    9
    The game that MADE Rockstar into what they are today. It revolutionized the fantastic open world sandbox gameplay that Ocarina of Time and Super Mario 64 did three years before this game came out. It also led to the GTA clone genre.

    The graphics and environment looked so mesmerizing back in 2001 but wow they didn't age well. I loved the radio stations Flashback 98.3 and Game FM. The
    The game that MADE Rockstar into what they are today. It revolutionized the fantastic open world sandbox gameplay that Ocarina of Time and Super Mario 64 did three years before this game came out. It also led to the GTA clone genre.

    The graphics and environment looked so mesmerizing back in 2001 but wow they didn't age well. I loved the radio stations Flashback 98.3 and Game FM. The sound was pretty good. Very impressive actors and actresses doing fantastic voice acting that would significantly improve as the series continued. The gameplay needs no description. It's so influential and mind-blowing. The story was fantastic. I did like Claude. He was strange yet captivating because he was silent and a criminal but he was also a messenger boy. Tommy Vercetti would blow Claude out of the water in Vice City the next year and so would Carl Johnson in San Andreas.

    I adored the vehicle missions, import garages, hidden packages and rampages.

    It suffers from many flaws: weak soundtrack, useless map, no map menu in pause menu, woeful frame-rate and slowdown and poor aiming controls.

    Every game that followed from this one would heavily improve and the flaws would be gone.

    A classic which paved the way for even better games up to GTA 5.
    Expand
  85. Jul 18, 2023
    8
    This was my introduction to the GTA series. I enjoyed the story & characters. I also liked just driving around and reeking havoc on the civilians.
  86. May 24, 2017
    10
    this is an epic game but has not aged well from later grand theft auto games. but otherwise its got fun missions and a good world. it is a ps2 classic
  87. Aug 9, 2017
    10
    After 16 years after the release of this game, it is still valekolepna and interesting as ever and GTA III not need in the view. This game is a legend and everyone should know about it
  88. Apr 2, 2023
    9
    "Grand Theft Auto III" revolutionized the video game industry with its introduction of the 3D open world. At the time of release, it was highly controversial since it allowed players to engage in all sorts of major criminal activities. Nevertheless, GTA III was a huge hit and has been named one of the greatest video games ever made by several critics. This is a satirical action-adventure"Grand Theft Auto III" revolutionized the video game industry with its introduction of the 3D open world. At the time of release, it was highly controversial since it allowed players to engage in all sorts of major criminal activities. Nevertheless, GTA III was a huge hit and has been named one of the greatest video games ever made by several critics. This is a satirical action-adventure influenced by Hollywood mob films. It's a tasteless guilty pleasure meant for a mature audience. Great wicked fun. Despite its flaws, this is the first GTA that set up the template for future entries and inspired countless of open-world games. I would rate it with a 9.6 out of 10. Expand
  89. Mar 1, 2018
    9
    Bueno que decir de una de las sagas mas famosas del mundo mundial, alguien que no haya escuchado sobre GTA en la actualidad no es un gamer.
    Este fue el primer juego de la saga que se puso en 3d y en tercera persona, ya que las dos entregas anteriores se veía desde arriba, no se muy bien como se le llama a ese tipo de genero de videojuegos.
    En la radio hay bastante variedad para escuchar
    Bueno que decir de una de las sagas mas famosas del mundo mundial, alguien que no haya escuchado sobre GTA en la actualidad no es un gamer.
    Este fue el primer juego de la saga que se puso en 3d y en tercera persona, ya que las dos entregas anteriores se veía desde arriba, no se muy bien como se le llama a ese tipo de genero de videojuegos.
    En la radio hay bastante variedad para escuchar y el juego en historia por lo menos a mi me lleno, no quiero comentar mucho sobre eso porque no quiero que allá Spoilers.
    Expand
  90. Jan 5, 2019
    9
    Grand Theft Auto III is an extremely ambitious attempt to bring the series' ultraviolent mayhem to the 3D world for the first time. In 2001, no one yet had really tried making a game like it, with the exception of Driver, which was an intense chase game with less grandiose expectations for itself than GTA III.

    You play as the silent Claude, a recently escaped prisoner who ends up taking
    Grand Theft Auto III is an extremely ambitious attempt to bring the series' ultraviolent mayhem to the 3D world for the first time. In 2001, no one yet had really tried making a game like it, with the exception of Driver, which was an intense chase game with less grandiose expectations for itself than GTA III.

    You play as the silent Claude, a recently escaped prisoner who ends up taking all sorts of dirty jobs around town. Even though Claude doesn't say anything or really have much of a personality (I suppose you get to choose what kind of person he is), the other characters in the game do. Most everyone you meet has a few screws loose and is up to no good. The darkly humorous exchanges you'll have with these characters adds to the atmosphere and style of the game.

    The main premise of GTA III is that you wander around a living, breathing world in which any car is free for you to take (though not necessarily with the blessing of the owner or police). There are no rules.

    There are a lot of different vehicles in the game, and they all drive differently as well. You can drive a blazing fast sports car or a dangerously heavy-duty fire truck (with which you can spray out fires, or just harass pedestrians with the hose). Almost everything is fun to drive, thanks to a solid physics engine. Your car will realistically spin out of control when a cop rams you, and when you're going fast, you FEEL it.

    Even if you're going for a relaxing drive across the incredibly immersive city, cruising is still fun thanks to the ability to listen to a variety of in-game radio stations. There's hip-hop, 80s pop, classical, and more, and a lot of the stations are straight-up infectious. Listening to talk shows or radio DJs is hilarious, due to the care Rockstar has put into the pervasive satire and dark comedy of this game. I found myself laughing a lot when I first started playing. The game does irreverence perfectly.

    GTA III has missions scattered around the city for you to find. Most of the missions involve driving around town, often killing rival mob members. While the third-person shooting mechanics are much more difficult and clunky than most first person shooters from this era, the ridiculous, over-the-top violence makes it tolerably satisfying. You can easily dispatch other characters into bloody corpses on the streets of Liberty City. If you lose all your health, you end up outside the Liberty City hospital - a nice touch. This game is full of little touches that improve immersion.

    While the game's missions are straightforward, there's a lot of freedom when it comes to approaching them. You may choose to kill a target with a grenade... but then there's the Uzi... or perhaps, just run him over a few times for good measure. The game gives you multiple options, and the missions are usually a lot of fun (especially when they involve explosives). The unfortunate aspect about the missions materializes when you fail them: you are forced to find the mission giver again, and go through the entire process. This starts to get annoying quickly, especially as many missions will have you driving all over town. The missions are hard enough that you will be going through a lot of retries to beat them, but luckily there are nearly always multiple missions to choose from.

    Another problem with the missions is that you frequently need to quickly get to locations that aren't on your map. A paint shop that disguises your car is extremely useful when the cops are on your tail, but where is that shop again? Leaving these locations unmarked makes these situations frustrating.

    The amazing thing about GTA III is the freedom. The tools it gives you to cause mayhem are varied, and you can get pretty creative with all the options. Sure, you can go to the gun shop and buy something, but you can also equip your car with a bomb. Maybe you feel like stealing a vehicle and throwing it into a trash compactor. The game continually reveals differing means of destruction, and then let's you use them as you like, even if you have no goal in mind. If you really feel like being a productive member of society, you can charge cab fare to take people to various locations or put out fires with a fire truck. This truly is an open-world video game.

    Besides your chaotic influence, computer-controlled cars will ram into each other, gang members will start shooting, and the game generally does a fantastic job of convincing you that it's real while making fun of the real world at the same time.

    Rockstar created a dense, smart, cool, and awe-inspiring world with Grand Theft Auto III, and it still shows today.
    Expand
  91. May 7, 2018
    10
    This game started the whole open world craze and the level of what you could do in this game at the time of release was crazy. Cheat codes most def bring the level of this game to super easy but at the same time super fun
  92. Dec 3, 2021
    8
    Groundbreaking game and decent storyline. Would definitely recommend for those who haven't played a GTA before
  93. Jan 12, 2019
    8
    The best part of the series, the atmosphere of real city. The main character is like a hipster, but in fact it is a very charismatic character.
  94. May 27, 2019
    10
    This GTA game is definitely better than GTA IV and this deserves a better user score than IV. The controls were really better than IV and the missions are much fun than IV and the characters are memorable just like San Andreas, V and Vice City. This game is amazing..
  95. May 19, 2023
    9
    GTA 3 was a groundbreaking achievement in gaming history that was so fresh. It blew everybody's mind back in the day.
  96. Feb 12, 2022
    10
    3-я знаминитая часть.
    Моя первая и любимая.
    С этой части я полюбил эту серию.
    Благодарность разработчикам.
  97. Jun 1, 2020
    8
    I know that this was one of the gtas and one of the most important games in the world, but unfortunately it has aged a lot, not only in the graphics that were a little out of date for the time, but also in the very slow and primitive gameplay. In addition, he is very difficult, seriously, he must be one of the most difficult gtas I have ever played, missions like "bomb base 2", "expres 2I know that this was one of the gtas and one of the most important games in the world, but unfortunately it has aged a lot, not only in the graphics that were a little out of date for the time, but also in the very slow and primitive gameplay. In addition, he is very difficult, seriously, he must be one of the most difficult gtas I have ever played, missions like "bomb base 2", "expres 2 go" and "SAM" are almost impossible and I couldn't finish this game without codes. Expand
  98. Oct 18, 2021
    10
    Seriously fun. Finished the game for the first time (with no cheat codes!) in 2021. I loved the simple story and the variety of missions. Learning how to navigate the map by memory is really enjoyable and proves you don’t need an in game map / full navigation system. This game doesn’t try to be overly realistic and the result is pure fun. I wasn’t expecting to enjoy playing this game soSeriously fun. Finished the game for the first time (with no cheat codes!) in 2021. I loved the simple story and the variety of missions. Learning how to navigate the map by memory is really enjoyable and proves you don’t need an in game map / full navigation system. This game doesn’t try to be overly realistic and the result is pure fun. I wasn’t expecting to enjoy playing this game so much and I can’t quite put into words what makes it so good. Expand
  99. Mar 8, 2022
    10
    My first game couldnt beat it cause i didnt have a memory card feels bad still a masterpiece
  100. Dec 7, 2022
    8
    The original open world sandbox game. 21 years after it's release GTA III holds up and is just as playable today as it was then.

Awards & Rankings

2
4
#4 Most Discussed PS2 Game of 2001
1
#1 Most Shared PS2 Game of 2001
Metascore
97

Universal acclaim - based on 56 Critic Reviews

Critic score distribution:
  1. Positive: 56 out of 56
  2. Mixed: 0 out of 56
  3. Negative: 0 out of 56
  1. The end-all, be-all of console action games. Period...For me GTA3 is the best action game I have ever played on a console system and I highly recommend it to adults (the intended audience of this game) who know the difference between good and evil.
  2. An insanely deep game that offers a lot to do outside of the 70+ missions. If you understand that it's just a game and that these selfsame actions are not healthy in the real world, you'll enjoy a well-developed world disguised as a deviously fun game.
  3. Next Generation Magazine
    80
    Adding to the frustration is the fact that your targeting system is practically useless, and the vehicle physics model is annoyingly floaty. [Jan 2002, p.78]