Grand Theft Auto III

 PlayStation 2
User Score
8.4

Generally favorable reviews- based on 1185 Ratings

User score distribution:
  1. Positive: 953 out of 1185
  2. Mixed: 150 out of 1185
  3. Negative: 82 out of 1185
Buy Now
Buy on

Review this game

  1. Your Score
    0 out of 10
    Rate this:
    • 10
    • 9
    • 8
    • 7
    • 6
    • 5
    • 4
    • 3
    • 2
    • 1
    • 0
    • 0
  1. Submit
  2. Check Spelling
view
per page
  1. nerrstyBthirsty
    Apr 16, 2013
    10
    Grand Theft Auto III is, quite simply, one of the greatest video game accomplishments in history. It single-handedly invented the sandbox genre, and it's my favorite video game of all time. It gets nearly everything it tries to do right, and in doing so, made history. The open ended gameplay is always fun, but that's what most people focus on, but who could blame them? Before GTA III,Grand Theft Auto III is, quite simply, one of the greatest video game accomplishments in history. It single-handedly invented the sandbox genre, and it's my favorite video game of all time. It gets nearly everything it tries to do right, and in doing so, made history. The open ended gameplay is always fun, but that's what most people focus on, but who could blame them? Before GTA III, gamers had never played anything like this before. However, there is a story here revolving around structured missions that shouldn't be missed. GTA III combines action/adventure and driving games flawlessly. With its respectable amount of vehicle and weapon choices, alongside the size of the map and the progressively tougher story missions, this is an extremely varied game that will almost sate anyone's appetite for a lengthy adventure to sink their teeth into. The story itself is, admittedly, nothing special, but with the sheer size of this game (for its time), to even incorporate a flowing narrative is, without a doubt, something to marvel. That's basically how I saw this game when it was released; something I was absolutely in awe at. The controls are spot on for driving, walking around, punching random pedestrians, etc., but the targeting system for aiming weapons will leave a bad taste with some gamers. Does that make it bad? No. Once you learn how to use it (along with conserving health and armor) you can get through any mission with minimal trouble. Any reviewer who could possibly label this masterpiece as a bad game simply has no business reviewing video games. That Sleeping Dogs, Crackdown, Infamous games you've been playing? All of those owe GTA III, big time. This game is the blueprint for sandbox games, and a damn fine model to go from, at that. Even games like the Tony Hawk franchise took note of the open world design in later entries, and it's hard to say that GTA III didn't have a hand in inspiring any of the games I've mentioned above. It's simply a monumental title that must be played by anyone who's mature enough to handle its visceral, gritty violence. I'll be the first to admit that it's not perfect, but it's so, so close to it, and is easily my favorite game in the GTA series. I'd even dare say that if you give this game a bad review, you had no business playing video games in general. GTA III has so much great going for it, you'll easily overlook the bad if you simply just take the time to get used to it. Which sadly, a minority of people won't. Their loss. 10/10.… Expand
  2. Jack97
    Jan 1, 2014
    8
    Grand Theft Auto 3 was a huge leap forward for videogame history as it featured one of the first fully 3D open world environments and a good story mode.
  3. Annoymous1
    Mar 16, 2013
    10
    Cool am Ivan is 0% right. GTA III is the best PlayStation 2 game ever so dont listen to um..."Cool" am Ivan. The story-line is breathtaking and has a awesome set of missions, including Toni Cipriani!
  4. 2ksnipefest
    Dec 27, 2013
    10
    I sold my n 64 and 30 some odd games plus a ps1 and some more games to buy a PS2 and GTA 3. It was worth it. I Love how revolutionary this game was. I brought open real worlds gaming to the millennium. Boy gaming wise this started will an earthquake that shocked the gaming industry. One of the most innovative titles i have ever had the grace to play. Plus the main character does not haveI sold my n 64 and 30 some odd games plus a ps1 and some more games to buy a PS2 and GTA 3. It was worth it. I Love how revolutionary this game was. I brought open real worlds gaming to the millennium. Boy gaming wise this started will an earthquake that shocked the gaming industry. One of the most innovative titles i have ever had the grace to play. Plus the main character does not have an annoying voice nor does he say cheesy cliches.… Expand
  5. JomartheGreat
    Sep 28, 2013
    10
    The second game after MGS 2 that started the 3D era. Playing this game really see how crime really dangerous is, so kids learn not to copy these actions or you might end up in jail. The game is exciting,
    good to kill civilians and things to do are superb. Classic.
  6. Fedelca
    Sep 29, 2013
    10
    Si bien para mí "Grand Theft Auto" empezó en Vice City, "Grand Theft Auto III" es legendario y digno de cualquier espectador que siga disfrutando de una de mis consolas favoritas: la legendaria PlayStation 2, y ¿Por qué es mi favorita? Porque juegos como "Gand Theft Auto III" se presentaron para esta increíble consola. Impresionante lo que se es capaz de hacer en este mapa y me acuerdoSi bien para mí "Grand Theft Auto" empezó en Vice City, "Grand Theft Auto III" es legendario y digno de cualquier espectador que siga disfrutando de una de mis consolas favoritas: la legendaria PlayStation 2, y ¿Por qué es mi favorita? Porque juegos como "Gand Theft Auto III" se presentaron para esta increíble consola. Impresionante lo que se es capaz de hacer en este mapa y me acuerdo hace mucho tiempo la primera vez que lo jugué casi estaba por llorar porque directamente era hermoso lo que pasaba por mis ojos. "Grand Theft Auto" manda.… Expand
  7. SammyHauguth
    Aug 29, 2023
    0
    Worst game ever made, and It's by the idiots at Rockstar Games. I don't understand how any one could even give this garbage score at all. It's so bad a d such a garbage.
  8. joao1198pedro
    Oct 30, 2013
    8
    the two firsts gta games were nothing special,but in the third game and with another generation they made something really special and terrific,this game would change this series forever.
  9. JohnLennon
    Apr 21, 2014
    10
    The Best in the Grand Theft Auto Series gorgeous graphics good story line awesome controls great characters i think this is the Citizen Kane of gaming in my opinion i recommend playing this awesome game
  10. VALVeY
    Nov 18, 2014
    8
    THIS GAME IS SO AWESOME ! The only thing I complain about is the controls other than that this game is awesome ! It has cool graphics great gameplay and variety for weapons ! GET THIS GAME ON THE PSN
  11. Henza27
    Jul 16, 2014
    10
    I love all the characters in this game, I love Claude, I love almost everything in this game. GTA V and GTA IV don't have that feeling I have with older GTA games. If you see this game on sale, GET IT!!! Steam can have my $3.74 for this game :)
  12. Scytherax
    Aug 15, 2014
    8
    This review contains spoilers, click expand to view. Grand Theft Auto III is one of a kind. With a 3D and 2D Third Person View, epic artwork for the Heads Up Display and 3D models like no other in the time, Grand Theft Auto III has nailed the best Graphic Design I have ever seen that comes from the year it was made. Sure, there are other good designs like the Elder Scrolls at the time but the artwork on the box and in game makes me go "Holy f*ckin' ****

    The gameplay has again, a 3D and 2D Third Person View, making this as view-customizable as Fallout. The free roam is quick but locked places can take time to UNlock the locations. Although there aren't many character customization options (-1), there is quite an array of weapons available to the player. Unlike San Andreas, it was a shame that the game had a garage without any modification options, making the vehicles barely customizable (-1).

    However, I like the way when you kick someone, you actually get money unlike the nowadays Grand Theft Auto where it automatically drops out of the victim's wallet after being killed. Not to mention geting stacks of money only worth up to $50.

    Grand Theft Auto III will always be one game withing my heart, even in this year of 2014.    … Expand
  13. SythusRATINGS
    Oct 19, 2014
    9
    Players are put at the heart of their very own gangster movie, and let loose in a fully-realised 3 dimensional city with a cast of hundreds, 50 plus vehicles, ranging from sports cars to ice cream trucks and from boats to buses, 3 hours of music, including opera, reggae, house, drum and bass, pop and disco, and a huge array of street ready weapons.
  14. LatinCritic13
    Jul 11, 2020
    10
    Grand Theft Auto III is the only 3D open world game that started it all and it’s a revolutionizing gamechanging masterpiece.
  15. DailySalesman
    Mar 22, 2015
    8
    The days before Grand Theft Auto became a world of sexual themes was certainly a good one even if I am now shaking my head at the amount of strong language featured here. The graphics here are a bit under par if I do say so myself but the gameplay itself is top notch. Grand Theft Auto III is quite simply put a fun romp through a huge city. It's incredibly innovate yet outlandish at theThe days before Grand Theft Auto became a world of sexual themes was certainly a good one even if I am now shaking my head at the amount of strong language featured here. The graphics here are a bit under par if I do say so myself but the gameplay itself is top notch. Grand Theft Auto III is quite simply put a fun romp through a huge city. It's incredibly innovate yet outlandish at the same time and that is what defines GTA.… Expand
  16. TheBlok
    Aug 8, 2015
    10
    Very good! Game with great storyline, gameplay , story , graphics for that time , cars, weapons and all! Very much recommend this game ! I played as a child, always had difficulty in some missions until passed, but after battling ! That's because I was very bad at playing , was the first 3D game I played in my life , the graphics were simply sensational when I played for the first time !
  17. SkullBallCorp
    Aug 12, 2015
    10
    The second best GTA of them all!
    Let me put one thing out there, this was not my first GTA game. My first was GTA 2 then 1 and then 3. Mentioning that is just to show that it is not nostalgia alone speaking when I say that the only GTA to beat this in my eyes was GTA V. Many people prefer San Andreas (and with good reason) however I felt that game was too clustered for its own good which    The second best GTA of them all!
    Let me put one thing out there, this was not my first GTA game. My first was GTA 2 then 1 and then 3. Mentioning that is just to show that it is not nostalgia alone speaking when I say that the only GTA to beat this in my eyes was GTA V. Many people prefer San Andreas (and with good reason) however I felt that game was too clustered for its own good which made performance suffer greatly back in the day on consoles. This game has a great story in a dark realistic Liberty City with missions taking you to work with the mob, help out club owners or just create general mayhem! The graphics may not have aged well but they aren't painful to look at by any means and the game is still a joy to play. Especially with cheats.    … Expand
  18. Cmmcfreire
    May 7, 2020
    7
    Story - 7/10
    Gameplay - 7/10
    Graphics - 7/10
    Soundtrack - 7/10
    Levels - 8/10
    Replay value - 7/10
  19. Cr37994
    Dec 24, 2015
    10
    Amazing game. Truly a revolutionary masterpiece. Anyone that doesn't like this game is on crack. So much variety, such a classic that helped shape games of this genre. Wether it's street racing or killing people, there is some thing for every one.
  20. noctis242
    Jan 12, 2016
    0
    Almost same score than gta san andreas? ... This is pathetic cause is 100% more limited than the last gta of ps2.

    You can't ride bisycles here, buy clothes, if you want to fly you cant take an airplane and fly the world you have to use glitchs in the game, you can't buy nothing apart of weapons, You cant increase your stats to run more time, not even go to a gym or eat, cant swim and    Almost same score than gta san andreas? ... This is pathetic cause is 100% more limited than the last gta of ps2.

    You can't ride bisycles here, buy clothes, if you want to fly you cant take an airplane and fly the world you have to use glitchs in the game, you can't buy nothing apart of weapons, You cant increase your stats to run more time, not even go to a gym or eat, cant swim and much more things..

    For the moment this game went on sale was very good but as best ps2 game of gta lacks too much.    … Expand
  21. Barnes1987
    Mar 6, 2017
    10
    GTA's first 3D venture turned out to be one the best games ever. This game blew my mind on christmas day 2001. Endless hours spent playing this game make it a must play game.
  22. BreakingAwesome
    May 13, 2016
    10
    Самая значимая игра в серии и одна из самых значимых вообще в игровой индустрии. Одна из первых игр, которая продвинула PS2. Первая 3D-игра в серии. Незамысловатый простой сюжет, где грабителя по имени Клод, предала Каталина. Естественно главный герой хочет отомстить. Этого он и пытается добиться в течении всей игры. Ему придется стать водителем, наёмником, убийцей. Он всё сделает радиСамая значимая игра в серии и одна из самых значимых вообще в игровой индустрии. Одна из первых игр, которая продвинула PS2. Первая 3D-игра в серии. Незамысловатый простой сюжет, где грабителя по имени Клод, предала Каталина. Естественно главный герой хочет отомстить. Этого он и пытается добиться в течении всей игры. Ему придется стать водителем, наёмником, убийцей. Он всё сделает ради денег. Геймплей тоже порадовал. Теперь это открытый мир без коридора, где можешь делать всё что захочешь. Графика на PS2-версии устарела, но всё равно ту мрачную атмосферу не передать словами. Абсолютно 10/10.… Expand
  23. Kingofdanerds
    Nov 10, 2016
    10
    Really like the story line. I mean you play a mute who needs to get through life in Liberty City. Sometimes it is just plain fun to just screw around. 10/10
  24. Progamer420
    Nov 13, 2016
    9
    GTA III... a great single player experience. The game play is good. There are plenty of missions in this game and all are very well made and fast paced. But there are are numerous glitches in the game. The story is well balanced. About the graphics... They are good for 2001. But sometimes the game lacks depth.
    Overall a great open world game with significant amount of features and also    GTA III... a great single player experience. The game play is good. There are plenty of missions in this game and all are very well made and fast paced. But there are are numerous glitches in the game. The story is well balanced. About the graphics... They are good for 2001. But sometimes the game lacks depth.
    Overall a great open world game with significant amount of features and also have some down points too.    … Expand
  25. AndrewWen
    Jan 26, 2017
    10
    Out of this world!One of the game that you must play before you die!A game that shock us again since Doom!It Almost the best PS2 game.But after you beat the game(complete 100%)you will feel bored.
  26. PresidentTrump
    Oct 28, 2017
    7
    After getting this pain-in-the-ass of a game to start, the ass pain didn't stop.
    The resolution was garbage and alt-tabbing out of the game took forever.
    I installed the silent patch and some other gameplay fixing mods. Now the pain can stop. For now. The story: A guy named Claude gets shot by his girlfriend while robbing a bank. He's arrested but breaks out with his boy 8-Ball.    After getting this pain-in-the-ass of a game to start, the ass pain didn't stop.
    The resolution was garbage and alt-tabbing out of the game took forever.
    I installed the silent patch and some other gameplay fixing mods.
    Now the pain can stop. For now.

    The story:
    A guy named Claude gets shot by his girlfriend while robbing a bank. He's arrested but breaks out with his boy 8-Ball. Claude works up the ranks trying to make money and find Catalina. He works for the Mafia, the Yakuza, and others. He eventually finds Catalina and shoots her down out of her helicopter and Claude walks off with his new girl, Maria.

    The gameplay:
    Some clunky driving. Horrible driver AI since they crash into you constantly because they switch lanes with no warning.
    Bad Shooting. The game is heavily outdated. Most missions suffer because of this. It's either the driving or the Cartel mows you down with their M16 that will kill you in a literal second.

    The graphics and cinematics:
    The graphics in GTA 3 are meh. The game is 15 years old (holy sh*t) so the graphics aren't going to be that great. Even though, the game still looks good. If you get the resolution fix mod, the game looks less pixeled and you can experience the game PS2 style. The cinematics and cutscenes are alright. Although it feels really awkward when Claude walks into this guys house, he tells Claude what to do, and Claude just nods his head after doing so. Claude has no real interaction with characters, which makes them feel flat. Only in missions where two other characters interact, is where the dialogue writing shines.

    Soundtrack:
    Most of it was awful to me. I'm the type of guy that can listen to mostly anything, so that's a lot. I liked Game FM and Flashback. The Jamaican and classical music didn't fit the environment and got annoying. Even on stations, I liked, there were only 6 or so songs. So you're constantly hearing that one song that goes "We're gon give this all that we gooot, keep on risin to the top!" and it gets really annoying. Most of the time I actually just listen to Lazlow talk about stupid sh*t.

    The missions from hell:
    The last about 10-15 missions are so ball burstingly hard, I almost skipped this game and went to Vice City.

    -Donald Love's Missions - Liberator
    Save some old dude from Cartel. Sounds easy until they tear you apart with M16s.
    Donald's Mission - Waka-Gashira Wipeout
    Kill Kenji, a leader of the Yakuza gang (also the guy you worked for) to start a gang war between Yakuza and cartel. You can't leave your car (since it's a cartel car and your identity will be revealed if you leave) so if the car is on fire, it's over. They shoot at your car with M16's which will destroy it in seconds, while you must drive by ONE GUY and if you fail to hit him, it's over.
    Donalds Mission - A Drop in the Ocean.
    Pick up some packages that a plane drops, while each package gives you one star. There are 6 packages. The boat controls are clunky and the water feels really weird. And when you're driving to the paint n spray (THAT ISN'T MARKED ON THE MAP) you're getting rammed with FBI cars and SWAT trucks.
    Donald's Mission - Grand Theft Aero
    Guess what, that last mission didn't matter. It was just a decoy, lol. Drive to another island you've never seen before, then drive back to the other island and kill Cartel members armed with M16 that will kill you damn near instantly. They're hiding around tight corners and the **** aiming doesn't help.
    The rest of Donald's mission isn't bad, Akuza's is though.
    Akuza's mission - Bait
    You drive around the new island, leading Cartel death squads to a Yakuza hid out so they're killed. Yeah, except the Yakuza are garbage and you have to kill them yourself at the death squad, or else they get away.
    Akuza's mission - Espresso 2 Go!
    One of the hardest in the series, trust me I've played them all.
    You drive around THE WHOLE MAP in 7 minutes. AND THERE IS NO FULL MAP ONLY A MINI MAP AND YOU HAVE TO DRIVE AROUND BEFORE DESTROYING THE COFFEE STANDS BECAUSE THEN THE MARKERS DON'T SHOW UP F*CK THIS MISSION!
    Akuza's Mission - S.A.M
    Another one of the hardest in the series. You blow up a plane mid-air in a boat. You have to STOP the boat. And aim your rocket launcher, if it misses, tries again. Or you could cheat in a tank and blow the cartel and police to Kingdom f*ck and get it over with.

    But what there's more!:
    There are some nice side missions in GTA 3 that are nice. Hidden Packages that give you weapon pickups outside your safehouse per 10 collected out of 100. The map is small and easy so it's now that bad.
    Paramedic - Pick people up and drive them to the hospital in a timelimit, and you can't crash. If the Mafia hates you, good f*cking luck since now they got shotguns that blow you to kingdom f*ck.
    Do I recommend the game?
    Yeah. As much as I hated the end missions, I had fun getting the collectibles and a lot of the earlier missions. I recommend on sale or even at its normal price    … Expand
  27. evolution98
    Sep 17, 2018
    9
    The game that MADE Rockstar into what they are today. It revolutionized the fantastic open world sandbox gameplay that Ocarina of Time and Super Mario 64 did three years before this game came out. It also led to the GTA clone genre.

    The graphics and environment looked so mesmerizing back in 2001 but wow they didn't age well. I loved the radio stations Flashback 98.3 and Game FM. The    The game that MADE Rockstar into what they are today. It revolutionized the fantastic open world sandbox gameplay that Ocarina of Time and Super Mario 64 did three years before this game came out. It also led to the GTA clone genre.

    The graphics and environment looked so mesmerizing back in 2001 but wow they didn't age well. I loved the radio stations Flashback 98.3 and Game FM. The sound was pretty good. Very impressive actors and actresses doing fantastic voice acting that would significantly improve as the series continued. The gameplay needs no description. It's so influential and mind-blowing. The story was fantastic. I did like Claude. He was strange yet captivating because he was silent and a criminal but he was also a messenger boy. Tommy Vercetti would blow Claude out of the water in Vice City the next year and so would Carl Johnson in San Andreas.

    I adored the vehicle missions, import garages, hidden packages and rampages.

    It suffers from many flaws: weak soundtrack, useless map, no map menu in pause menu, woeful frame-rate and slowdown and poor aiming controls.

    Every game that followed from this one would heavily improve and the flaws would be gone.

    A classic which paved the way for even better games up to GTA 5.    … Expand
  28. SSJGodku
    Jul 18, 2023
    8
    This was my introduction to the GTA series. I enjoyed the story & characters. I also liked just driving around and reeking havoc on the civilians.
  29. immadbro64
    May 24, 2017
    10
    this is an epic game but has not aged well from later grand theft auto games. but otherwise its got fun missions and a good world. it is a ps2 classic
  30. SkeletonBones
    Aug 9, 2017
    10
    After 16 years after the release of this game, it is still valekolepna and interesting as ever and GTA III not need in the view. This game is a legend and everyone should know about it
  31. Alex_Pilgrim008
    Apr 2, 2023
    9
    "Grand Theft Auto III" revolutionized the video game industry with its introduction of the 3D open world. At the time of release, it was highly controversial since it allowed players to engage in all sorts of major criminal activities. Nevertheless, GTA III was a huge hit and has been named one of the greatest video games ever made by several critics. This is a satirical action-adventure"Grand Theft Auto III" revolutionized the video game industry with its introduction of the 3D open world. At the time of release, it was highly controversial since it allowed players to engage in all sorts of major criminal activities. Nevertheless, GTA III was a huge hit and has been named one of the greatest video games ever made by several critics. This is a satirical action-adventure influenced by Hollywood mob films. It's a tasteless guilty pleasure meant for a mature audience. Great wicked fun. Despite its flaws, this is the first GTA that set up the template for future entries and inspired countless of open-world games. I would rate it with a 9.6 out of 10.… Expand
  32. LasPlays
    Mar 1, 2018
    9
    Bueno que decir de una de las sagas mas famosas del mundo mundial, alguien que no haya escuchado sobre GTA en la actualidad no es un gamer.
    Este fue el primer juego de la saga que se puso en 3d y en tercera persona, ya que las dos entregas anteriores se veía desde arriba, no se muy bien como se le llama a ese tipo de genero de videojuegos.
    En la radio hay bastante variedad para escuchar    Bueno que decir de una de las sagas mas famosas del mundo mundial, alguien que no haya escuchado sobre GTA en la actualidad no es un gamer.
    Este fue el primer juego de la saga que se puso en 3d y en tercera persona, ya que las dos entregas anteriores se veía desde arriba, no se muy bien como se le llama a ese tipo de genero de videojuegos.
    En la radio hay bastante variedad para escuchar y el juego en historia por lo menos a mi me lleno, no quiero comentar mucho sobre eso porque no quiero que allá Spoilers.    … Expand
  33. md5fungi
    Jan 5, 2019
    9
    Grand Theft Auto III is an extremely ambitious attempt to bring the series' ultraviolent mayhem to the 3D world for the first time. In 2001, no one yet had really tried making a game like it, with the exception of Driver, which was an intense chase game with less grandiose expectations for itself than GTA III.

    You play as the silent Claude, a recently escaped prisoner who ends up taking    Grand Theft Auto III is an extremely ambitious attempt to bring the series' ultraviolent mayhem to the 3D world for the first time. In 2001, no one yet had really tried making a game like it, with the exception of Driver, which was an intense chase game with less grandiose expectations for itself than GTA III.

    You play as the silent Claude, a recently escaped prisoner who ends up taking all sorts of dirty jobs around town. Even though Claude doesn't say anything or really have much of a personality (I suppose you get to choose what kind of person he is), the other characters in the game do. Most everyone you meet has a few screws loose and is up to no good. The darkly humorous exchanges you'll have with these characters adds to the atmosphere and style of the game.

    The main premise of GTA III is that you wander around a living, breathing world in which any car is free for you to take (though not necessarily with the blessing of the owner or police). There are no rules.

    There are a lot of different vehicles in the game, and they all drive differently as well. You can drive a blazing fast sports car or a dangerously heavy-duty fire truck (with which you can spray out fires, or just harass pedestrians with the hose). Almost everything is fun to drive, thanks to a solid physics engine. Your car will realistically spin out of control when a cop rams you, and when you're going fast, you FEEL it.

    Even if you're going for a relaxing drive across the incredibly immersive city, cruising is still fun thanks to the ability to listen to a variety of in-game radio stations. There's hip-hop, 80s pop, classical, and more, and a lot of the stations are straight-up infectious. Listening to talk shows or radio DJs is hilarious, due to the care Rockstar has put into the pervasive satire and dark comedy of this game. I found myself laughing a lot when I first started playing. The game does irreverence perfectly.

    GTA III has missions scattered around the city for you to find. Most of the missions involve driving around town, often killing rival mob members. While the third-person shooting mechanics are much more difficult and clunky than most first person shooters from this era, the ridiculous, over-the-top violence makes it tolerably satisfying. You can easily dispatch other characters into bloody corpses on the streets of Liberty City. If you lose all your health, you end up outside the Liberty City hospital - a nice touch. This game is full of little touches that improve immersion.

    While the game's missions are straightforward, there's a lot of freedom when it comes to approaching them. You may choose to kill a target with a grenade... but then there's the Uzi... or perhaps, just run him over a few times for good measure. The game gives you multiple options, and the missions are usually a lot of fun (especially when they involve explosives). The unfortunate aspect about the missions materializes when you fail them: you are forced to find the mission giver again, and go through the entire process. This starts to get annoying quickly, especially as many missions will have you driving all over town. The missions are hard enough that you will be going through a lot of retries to beat them, but luckily there are nearly always multiple missions to choose from.

    Another problem with the missions is that you frequently need to quickly get to locations that aren't on your map. A paint shop that disguises your car is extremely useful when the cops are on your tail, but where is that shop again? Leaving these locations unmarked makes these situations frustrating.

    The amazing thing about GTA III is the freedom. The tools it gives you to cause mayhem are varied, and you can get pretty creative with all the options. Sure, you can go to the gun shop and buy something, but you can also equip your car with a bomb. Maybe you feel like stealing a vehicle and throwing it into a trash compactor. The game continually reveals differing means of destruction, and then let's you use them as you like, even if you have no goal in mind. If you really feel like being a productive member of society, you can charge cab fare to take people to various locations or put out fires with a fire truck. This truly is an open-world video game.

    Besides your chaotic influence, computer-controlled cars will ram into each other, gang members will start shooting, and the game generally does a fantastic job of convincing you that it's real while making fun of the real world at the same time.

    Rockstar created a dense, smart, cool, and awe-inspiring world with Grand Theft Auto III, and it still shows today.    … Expand
  34. AKthaBeast
    May 7, 2018
    10
    This game started the whole open world craze and the level of what you could do in this game at the time of release was crazy. Cheat codes most def bring the level of this game to super easy but at the same time super fun
  35. tomflanders
    Dec 3, 2021
    8
    Groundbreaking game and decent storyline. Would definitely recommend for those who haven't played a GTA before
  36. Sky_nemO
    Oct 10, 2018
    0
    Лучшая игра!!! С юмором и хорошей атмосферой!
  37. MicroscopicMoon
    Jan 12, 2019
    8
    The best part of the series, the atmosphere of real city. The main character is like a hipster, but in fact it is a very charismatic character.
  38. rz1993
    May 27, 2019
    10
    This GTA game is definitely better than GTA IV and this deserves a better user score than IV. The controls were really better than IV and the missions are much fun than IV and the characters are memorable just like San Andreas, V and Vice City. This game is amazing..
  39. Deathbringer_01
    Feb 19, 2020
    7
    GTA III foi uma experiência legal que tive na era do PS2, mas o jogo pra mim não é lá dos seus melhores, sinto que ele envelheceu muito mal e com razão, o jogo possui algumas missões bizarras ao estilo GTA mas existem exageros na polícia e em outras missões, os carros tem uma dirigibilidade péssima, mas é divertido.
  40. Flashyboy89
    May 19, 2023
    9
    GTA 3 was a groundbreaking achievement in gaming history that was so fresh. It blew everybody's mind back in the day.
  41. ONEEX
    Feb 12, 2022
    10
    3-я знаминитая часть.
    Моя первая и любимая.
    С этой части я полюбил эту серию.
    Благодарность разработчикам.
  42. ExplodingWalrus
    Nov 12, 2019
    6
    This game established a genre, and for that it deserves a great amount of respect. What's more, it has held up reasonably well and is still fun to play today. That said, there are a few shortcomings that are worth noting. Often, these make the game a mixed bag.

    The world is a joy to explore, but the plot is meandering and unexciting. While the game features an all-star voice cast, the    This game established a genre, and for that it deserves a great amount of respect. What's more, it has held up reasonably well and is still fun to play today. That said, there are a few shortcomings that are worth noting. Often, these make the game a mixed bag.

    The world is a joy to explore, but the plot is meandering and unexciting. While the game features an all-star voice cast, the script doesn't afford them much of an opportunity to show off their skills. The in-game radio features an impressive amount of content, but the sound effects are oftentimes grating, with shouting pedestrians and engine groans often making for a cacophonous experience. The layout of the game's three islands is enormously memorable, but this may just be a side-effect of the lack of a map screen, meaning that players are forced to memorize the layout of Liberty City's various streets. The controls work quite well while driving, but the on-foot controls are a frustrating mess, particularly during combat.

    This game laid the foundation for what would come after, and for that it remains a giant. There is still a lot of fun to be had here, though it is located more in the random chaos that can come from toying with the game's dynamic systems than with the simplistic and uninspired missions.

    Give the game a shot. It's worth your time. Just tenure your expectations. Later games in the series would do much to refine the formula established here.    … Expand
  43. hundead309
    Jun 1, 2020
    8
    I know that this was one of the gtas and one of the most important games in the world, but unfortunately it has aged a lot, not only in the graphics that were a little out of date for the time, but also in the very slow and primitive gameplay. In addition, he is very difficult, seriously, he must be one of the most difficult gtas I have ever played, missions like "bomb base 2", "expres 2I know that this was one of the gtas and one of the most important games in the world, but unfortunately it has aged a lot, not only in the graphics that were a little out of date for the time, but also in the very slow and primitive gameplay. In addition, he is very difficult, seriously, he must be one of the most difficult gtas I have ever played, missions like "bomb base 2", "expres 2 go" and "SAM" are almost impossible and I couldn't finish this game without codes.… Expand
  44. Kacak321
    Apr 13, 2020
    0
    Bad game.......................................................................
  45. Modax19
    Oct 18, 2021
    10
    Seriously fun. Finished the game for the first time (with no cheat codes!) in 2021. I loved the simple story and the variety of missions. Learning how to navigate the map by memory is really enjoyable and proves you don’t need an in game map / full navigation system. This game doesn’t try to be overly realistic and the result is pure fun. I wasn’t expecting to enjoy playing this game soSeriously fun. Finished the game for the first time (with no cheat codes!) in 2021. I loved the simple story and the variety of missions. Learning how to navigate the map by memory is really enjoyable and proves you don’t need an in game map / full navigation system. This game doesn’t try to be overly realistic and the result is pure fun. I wasn’t expecting to enjoy playing this game so much and I can’t quite put into words what makes it so good.… Expand
  46. Draco9
    Mar 8, 2022
    10
    My first game couldnt beat it cause i didnt have a memory card feels bad still a masterpiece
  47. Raymond86
    Dec 7, 2022
    8
    The original open world sandbox game. 21 years after it's release GTA III holds up and is just as playable today as it was then.
  48. Soldier1stClass
    Jul 23, 2020
    9
    When I was younger GT3 blew my mind when it 1st came out. It was my 1st experience with the GTA franchise and the game was an amazing product for it's t's time. I still play it every once in awhile.
  49. JWest132
    Aug 6, 2020
    10
    Grand Theft Auto 3 will always be a classic that has flaws. Flaws that it’s predecessors fix. And yes Vice City and San Andres are better games, but there is just something about the simplicity of GTA 3. It’s one of if not the most innovative game of all time. One of the most influential games of my life. I love this game 10/10.
  50. sethbroker
    Oct 25, 2020
    10
    Wow I cant say no more ! I love it , absolutely stunning, best game everrrrrrr!
  51. Sherbert
    Nov 10, 2020
    6
    Obviously, we need to take Metacritic's "must plays" with a grain of salt. I don't care about whether a game was influential, I care about whether it's enjoyable to play now. I played the game to 100%, I did everything. It was certainly fun overall, but I wouldn't recommend it to the average player. The game has aged, if you want to run around and wreck havoc, play GTA V. There is noObviously, we need to take Metacritic's "must plays" with a grain of salt. I don't care about whether a game was influential, I care about whether it's enjoyable to play now. I played the game to 100%, I did everything. It was certainly fun overall, but I wouldn't recommend it to the average player. The game has aged, if you want to run around and wreck havoc, play GTA V. There is no reason to come back to III, unless you want to sit in your car and listen to Chatterbox FM. In that case, it's understandable.… Expand
  52. Thefreecritic
    Jan 17, 2021
    10
    Nostalgic game :)))))))))))))))))
    I want to go back to that time :)))))))))))))))))))))
    It was a revolutionary game of its time, and Rockstar owes it
    I love this game
  53. Brunoprado
    Jan 29, 2021
    10
    Muito bom muito bom muito bom muito bom muito bom muito bom muito bom muito bom
  54. Bivshtex007
    Nov 13, 2022
    10
    I am SO glad that this game (PS2 Version) is available on PS4! I enjoyed every bit of it, even with outdated controls. Gameplay, Challanges, everything
  55. yjwno0
    Jan 6, 2021
    10
    Most innovative gameplay compared to GTA V.
    I've played a lots of GTA games including GTA Advance, GTA CTW, GTA VC, GTA SA, GTA 4, GTA 5, but I can guarantee GTA 3 is the best of them all.
  56. psmoon21
    Jan 27, 2021
    10
    The game that changed the open worlds

    Even with a mute character he has an incredible story for his time, with many things to do and fun missions

    gta iii is the game that everyone who played the first gta wanted for the saga.

    this is one of the games that moved this industry forward
  57. lSAGGERl
    Mar 3, 2021
    10
    Revolución. Nunca antes se habia visto nada igual, esto si era un mundo libre y realista donde en los CRT de la epoca se disfrutaba y se veia muy realista en esos años. Juegazo que cambió todo. Divertido y con muy buena banda sonora. Pegó fuerte entre los chavales.
  58. Ardho
    Aug 30, 2021
    9
    The game is so good, that other games feel outdated, what a big step for the game world
  59. Lyralei3
    Feb 26, 2023
    8
    GTA III - самая недооцененная часть гта и самая жестокая гта с хорошей атмосферой
    Оцениваю игру на 8/10
  60. Dareix
    May 17, 2021
    6
    gli metto un 6 solo perché è stato il primo gta in 3d e perché è uscito anni fa, ma giocarlo oggi è veramente noioso ed è privo di contenuti, idem la storia, interessante ma neanche piu di tanto
  61. Killsheer
    Jun 10, 2021
    10
    One of the best PS2 games, besides being my 4th Favorite GTA, Bad Musics and Final Mission
  62. CloudStrife05
    Aug 21, 2021
    9
    And the world was never the same again... That is what should be said whenever talking about GTA3.
  63. grimreapersims
    Sep 9, 2021
    8
    ....................................................................................................................................................................................................blank
  64. McQueen1911
    Sep 11, 2021
    10
    very good and fun game, especially the main characters voice acting. violence is very good too.
  65. Jattaman
    Oct 3, 2022
    9
    Il terzo capitolo rivoluziona la serie con il 3D.
    Perde l'originalità e la crudezza del primo episodio, ma stravolge in positivo per impatto grafico, giocabilità e maestosità del progetto.
  66. DonldTrump_45Th
    Jan 26, 2023
    8
    Hello, this is a default review because i'm forced to use 75 characters. I'll edit this review in the future talking about the game, don't worry ;)

    My final rate is: 8
  67. MatthewJamesBag
    Nov 18, 2021
    10
    GTA 3 Is Actually A Really Fun Game And It Has Really Really R E A L L Y Good Graphics And Sound Quality. Good Game Overall, 10/10
  68. Atay26
    Jan 7, 2022
    10
    This review contains spoilers, click expand to view. Such a revolutionary game for it's time, a MUST GET! This game has the most beautiful atmosphere I have ever seen in a video game. Characters, gameplay mechanics and story are very well achieved from such a huge transition between it's 2d processors to becoming a whole new fledged out 3d non linear experience. Claude the main protagonist is betrayed and left for dead by his ex girlfriend during a robbery, after escaping incarceration, he sets himself on a journey for revenge, even if it means working for the biggest crime Lord's of liberty city's criminal underworld Just to get closer to reach your goal.… Expand
  69. Runatikku
    Feb 1, 2022
    9
    This game is a groundbreaking game in the gaming world. I remember my brain stopped the first time I played it. I don't remember any game I've played before that gave me so much freedom. And the graphics, oh my god, my eyes melted when I saw the graphics of GTA 3, which had spent my life with NES games until then. The game I begged my family to buy a ps2. Generally speaking, it is not theThis game is a groundbreaking game in the gaming world. I remember my brain stopped the first time I played it. I don't remember any game I've played before that gave me so much freedom. And the graphics, oh my god, my eyes melted when I saw the graphics of GTA 3, which had spent my life with NES games until then. The game I begged my family to buy a ps2. Generally speaking, it is not the strongest game in the GTA series, but we have to accept that it is the game that started the legend. As I said, the graphics are very good for its time, the gameplay is also the same, even today I think it's still comfortably playable, the scenario is not very good, it's a classic revenge story, but because Claude is a total dull, he can't make us feel this feeling of revenge. Other than that, freedom, stealing cars, entering cheat codes, and attacking people are all as expected from a GTA game. I think it's a game that everyone should experience. The missions are generally pretty easy and short with a few exceptions. So I suggest you give it a try.… Expand
  70. DanThePerson
    Aug 27, 2022
    9
    once again this game has a cool premise and atmosphere, and bunch of other cool stuff, and the music/radio stations are one of my favorite things about the game.. but there's a inconsistent difficulty yet again, and also yet again it caused me to never beat this game.. I guess maybe the older a GTA game is, the harder it becomes..
  71. Ez1459
    Jan 22, 2023
    10
    grandfather of open world games, truly amazing and has a charm to it that will never vanish
  72. bewarbarzani26
    May 26, 2022
    2
    This review contains spoilers, click expand to view. Nslksnsksnsmssseemsmsndnndkdndndndjkdkdkdldjeebsbgtagtagtagattqqqgatagagatagtagatatagatgaagatagagataftaa… Expand
  73. dr-kenobi
    Sep 6, 2022
    9
    The case when the first real try is not a mess, but a huge hit. Truly the origin of the future best seller of the gaming world
  74. donkaapo
    Sep 15, 2022
    7
    blank..........................................................................................................................................................................................
  75. 3ls0ul
    Mar 6, 2023
    9
    Este juego aún no lo eh jugado o completado, así que pondré una reseña y nota diferentes cuando lo haga.
  76. Pereira2000
    Nov 12, 2022
    6
    He oido mucha gente diciendo que este juego es maravilloso por su censilleza pero a mi la historia me parecio muy mediocre. Hay que admitirlo es el gta que lo invento todo y se ve bien para tener mas de 20 años pero no me gusto y tiene la peor radio de toda la saga
  77. Uauqdemais
    Dec 28, 2022
    8
    O começo de algo pica, mas não é nem de perto perfeito. A gameplay é datada, sendo o principal problema deste jogo.
  78. Yojimbo2015
    Jul 28, 2023
    9
    Inevitably a little simplistic and crude compared to the later incarnations and some of the missions are frustratingly difficult thanks to the combination of dodgy AI and vehicles that are far too fragile, but it was a game changer at the time and was the genesis of the modern sandbox game.
  79. the4castlekings
    Jan 15, 2023
    1
    This game is awful. GTA3 is one of the most boring, unplayable games out there and it does not deserve the score it has. If the game was really a 10, it top GTA4 and GTA5 but it fails to put a dent in either of those games. Would not recommend
  80. fredijuts
    Jan 31, 2023
    10
    car go vroom so i be happy vroom vroom beep beep vroom vroom beep beep vroom vroom beep beep
  81. imalynxcat
    Apr 2, 2023
    6
    oynarken çok fazla hatayla karşılaştım ve san andreas oynadıktan sonra oynadığım için eğlenemedim.
  82. FINPOSTI
    May 19, 2023
    0
    no its not just good like its not just good as i thought that this game was supposed to be, i dont like the game as much as someone else does so i give this game this exact rating as it it showing here, i am not a pirate btw
  83. Pancakes-
    Jun 24, 2023
    10
    Es un hermoso juego, lo he completado en PC y Android, ambas son buenas experiencias, pero cuando decidí completarlo en mi vieja PS2 fue aún más emocionante.
    El juego tiene esa baja resolución típica de un juego del 2000, pero muchas cosas como la dificultad, la estética oscura no hacen más que notarse aún más.
    La dificultad en sí, es un juego difícil, el GTA con la campaña más difícil,    Es un hermoso juego, lo he completado en PC y Android, ambas son buenas experiencias, pero cuando decidí completarlo en mi vieja PS2 fue aún más emocionante.
    El juego tiene esa baja resolución típica de un juego del 2000, pero muchas cosas como la dificultad, la estética oscura no hacen más que notarse aún más.
    La dificultad en sí, es un juego difícil, el GTA con la campaña más difícil, debido a sus misiones cronometradas y largas persecuciones, sin embargo, si se lo domina bien, es una experiencia más disfrutable que frustrante, que no es una dificultad del otro mundo.
    La selección musical es hermosa y contribuye a sentimientos de acción, emoción, pero también de tristeza y soledad, debido a la frialdad del protagonista.
    En definitiva, un clásico que todo jugador debería probar al menos una vez, debido a que aún con su envejecimiento, puede suponer un poco de reto, por su conducción torpe y simple, o el regreso a un GTA más simple, alejado de toda mecánica secundaria lo máximo posible, y centrado en ser un juego que trajera la revolución del mundo abierto a la industria. It is a beautiful game, I have completed it on PC and Android, both are good experiences, but when I decided to complete it on my old PS2, it was even more exciting.

    The game has that typical low resolution of a game from 2000, but many things like the difficulty, the dark aesthetic, only stand out even more.

    The difficulty itself is a challenging game, the GTA with the hardest campaign, due to its timed missions and long chases. However, if you master it well, it is a more enjoyable experience than frustrating. It's not an otherworldly difficulty.

    The music selection is beautiful and contributes to feelings of action, excitement, but also sadness and loneliness, due to the coldness of the protagonist.

    In conclusion, it's a classic that every gamer should try at least once because even with its aging, it can still provide a bit of a challenge, whether it's the clunky and simplistic driving or the return to a simpler GTA, stripped of all secondary mechanics as much as possible, and focused on being a game that brought the open-world revolution to the industry.    … Expand
  84. zcat5
    Jun 26, 2023
    10
    Building upon the openness of Driver 2, this game redefined what an openworld game could be. This game is one of the most important games in history. I can't call it a masterpiece because it is heavily flawed, but for importance to gaming alone, this deserves a 10/10.
  85. 3run0
    Jul 17, 2023
    10
    The best game for the PS2.Still fun to this day destroying cars with rpgs and causing chaos.
  86. Warrior_of_Doom
    Jul 19, 2023
    9
    The overall score is based on how much fun I personally had with every component of the game
    and the overall experience.
  87. lizardkingg
    Jul 21, 2023
    10
    One of the most revolutionary games of all time. A groundbreaking masterpiece. Set the bar high for the rest of the gaming world. As much of a classic as it gets.
  88. kobaeee
    Sep 6, 2023
    10
    GTA 3 is the first open world game to do it correctly. It's a shame that this game still hasn't received a worthy remaster.
  89. VLG
    Aug 22, 2023
    9
    What can i say that has not been said a thousand times. Despite its obvious old age and crappy graphics, I have such good memories about it.
  90. ElKooi
    Aug 31, 2023
    7
    Graficos para su epoca: 7/10 los personajes les faltan dientes y tienen manos con dedos pegados
    Jugabilidad: 8/10 un apuntado automatico porque aun no habian juegos que adapten bien los shooters en consolas asi que fue bien implementarlo
    Mapa: Mundo abierto 9/10
    Misiones: 7/10 estan entretenidos

    El juego esta bueno pero envejecio mal por sus posteriores entregas por eso un 7
  91. SuperSonicJunus
    Sep 9, 2023
    5
    Never beat this one but I’ve gotten damn close so I think I can give it MY proper rating. Vice City was my 1st played GTA but this one was soon after. This game was pivotal in revolutionizing sandbox games but it’s really not good even for its time. It’s clunky, the protagonist is silent for some reason, and the soundtrack doesn’t come close to VC or SA. I’ll beat it one day, don’t reallyNever beat this one but I’ve gotten damn close so I think I can give it MY proper rating. Vice City was my 1st played GTA but this one was soon after. This game was pivotal in revolutionizing sandbox games but it’s really not good even for its time. It’s clunky, the protagonist is silent for some reason, and the soundtrack doesn’t come close to VC or SA. I’ll beat it one day, don’t really want to. Haha… Expand
  92. FarshadFido
    Sep 11, 2023
    10
    it was made only by Rockstar.gta 3 amazing game,niceeeeeeeeee eeeeeeeeereeeeee
next
Page:

Awards & Rankings

2
#2 Best PS2 Game of 2001
4
#4 Most Discussed PS2 Game of 2001
1
#1 Most Shared PS2 Game of 2001

Critic Reviews

All reviews »
Metascore
97

Universal acclaim - based on 56 Critic Reviews

Critic score distribution:
  1. Positive: 56 out of 56
  2. Mixed: 0 out of 56
  3. Negative: 0 out of 56
  1. Voodoo Extreme
    98
    The end-all, be-all of console action games. Period...For me GTA3 is the best action game I have ever played on a console system and I highly recommend it to adults (the intended audience of this game) who know the difference between good and evil.
    Read full review
  2. Into Liquid Sky
    100
    An insanely deep game that offers a lot to do outside of the 70+ missions. If you understand that it's just a game and that these selfsame actions are not healthy in the real world, you'll enjoy a well-developed world disguised as a deviously fun game.
    Read full review
  3. Next Generation Magazine
    80
    Adding to the frustration is the fact that your targeting system is practically useless, and the vehicle physics model is annoyingly floaty. [Jan 2002, p.78]
See all critic reviews »